Road To Redemption 9


Pre-Show: The Iconomy (Chris Elite, Eclipse Diemos, JJ Silva) vs. The High Rollerz and Greg Ward


( “Worlds Collide” by Nicki Taylor plays as a hype video plays, highlighting the four Elimination Chamber matches taking place in the evening. The camera then cuts to the Mercedes Benz Dome where fans are slowly filling in and “Worlds Collide” is playing over the loudspeakers. The fans already in attendance start cheering wildly )

Rex: In just an hour we will bring to you what could very well be one of the most important FPVs in EAW history! Until then, we’ve still got action to bring to you good fans on this glorious evening! I’m Rex McIntyre, sitting alongside —

HYC: HEY YO! Hey Yo Chico here, and you can bet your bottom dollar this will in fact be one of the most must-see FPVs in the history of EAW! Hell, maybe even in the history of all of pro wrestling! We’re live from the beautiful Mercedes Benz dome in New Orleans, and from what I’ve been told we are expecting a record turnout here at the Benz Dome! And if you’re wondering why, just take a look at that!

( Camera shows the Elimination Chamber hanging above the arena )

Rex: There it is, that is the focal point of this evening as tonight we host an UNPRECEDENTED FOUR Elimination Chambers.

HYC: That with a slew of other amazing matches ready for you tonight. But enough of our yapping, let’s get into some action!

( The camera cuts to the ring where the Ring Announcer is standing by with a mic in hand. )


Ring Announcer: The following contest is scheduled for one fall and is a six man tag team match! Introducing first…

( “Beast (Southpaw Remix)” by Rob Bailey begins to play as the crowd rises to their feet both cheering and booing. Chris Elite, JJ Silva, and Eclipse Diemos step out onto the stage and make their way to the ring. Elite and Silva stay behind Diemos the whole way. )

Ring Announcer: Making their way to the ring now… The team of Chris Elite, JJ Silva, and Eclipse Diemos… THEEEEE ICONNNOOOMMMYYYYY!!!!

Rex: What’s with Elite and Silva? It’s like they’re separating themselves from Diemos right now? You can’t tell me there’s still tension from Diemos taking the fall in the Grand Prix, is there?

HYC: Aw c’mon Rex you’re lookin’ too far into it! I wouldn’t think too much of it. They’re just making their way to the ring, it’s not like they’re screwing each other over.

Ring Announcer: And their opponents…

( “I Get Money” by 50 Cent begins to play and the crowd immediately begins to boo. Jack Ripley and David Davidson make their way to the ring. )

Ring Announcer: Entering the ring right now… The team of Jack Ripley and David Davidson… THEEEEE HIGGGGHHHH ROLLLLEEEEEEERRRRRZZZZZZZ!!!!!

HYC: You gotta ask yourself if these guys will actually be able to pull out the victory against the Iconomy.

Rex: I don’t know if they can–

( Interrupting the commentator, “Batman” by Dropkillers begins to play and Greg Ward makes his way to the ring focused on just the ring. The crowd begins a mixed reaction of cheers and boos. )

Ring Announcer: Teaming with The High Rollerz and making his way to the ring now… GREEEEEEGGGGGG WAAAAAARDDDDDDDD!!!!!!



Rex: Elite and Ward lock up in the middle and Ward starts to overpower him. Elite spins around and connects a quick german suplex! What a start for the Iconomy! Diemos and Silva are outside with The High Rollerz and are giving them hell! Diemos sends Ripley straight into the barricade! Silva is on the apron and here comes Davidson jumping onto the apron with Silva! Silva has Davidson in position… T-BONE SUPLEX ON THE SIDE OF THE APRON! WHAT A MOVE BY SILVA! Davidson and Ripley are both laid out outside of the ring and Silva and Diemos climb to their respective corners. Elite is stomping a mudhole right into Ward right now then climbs the top rope! SHOOTING STAR PRESS! WAIT NO! WARD GOT HIS KNEES UP AND ELITE LANDED RIGHT ON THEM! Ward is still the only member of his team in this with The High Rollerz finally starting to get to their feet! Ward takes this chance to get to his feet and grabs Elite to pull him up to a seated position. Ward rebounds off the ropes and connects a shining wizard knocking Elite out!

HYC: Ward pulls Elite away from his corner, but Elite kicks Ward off and jumps for the tag! He gets it! Here comes Silva charging in and clotheslines Ward! Ward back to a vertical base already and Silva charges with an uppercut knocking Ward groggy into the ropes! Silva steps back and dropkicks Ward knocking him out of the ring! What’s he doing now? He’s running out the ropes, rebounds and goes to fly out of the ring! BUT WARD WITH A JUMPING HEEL KICK TO STOP SILVA BEFORE HE COULD GET OUT OF THE RING! JUST AMAZING! Silva is laying in between the ropes and Ward gets on the apron! He runs at Silva and connects a leg drop! Silva goes flying back after his throat was just crushed between a leg and a rope! Ward goes for the cover!

Ref: ONEEEEEE!!!!!


Rex: Kickout at two for Silva! The High Rollerz are finally in their corners and Ward drags Silva and tags in Ripley! Ward holds Silva and Ripley starts throwing punches straight into his chest! Ward steps onto the outside apron and Ripley sends Silva right into the ropes. He rebounds and Ripley connects a dropkick! Silva is immediately back on his feet and Ripley tries to whip him again, but Silva reverses it into his own and sends Ripley right into his corner turnbuckle. Diemos reaches for the tag but Silva tags in Elite instead! Silva grabs Ripley and connects a scoop slam while Elite climbs the turnbuckle. DIVING MOONSAULT! IT CONNECTS! ELITE WITH THE COVER!

Ref: ONEEEEE!!!!!! TWOOOO!!!!!!!!!

HYC: Davidson breaks up the pin and here comes The Iconomy and Greg Ward battling it out in the ring! DIEMOS SENDS DAVIDSON OUTSIDE THE RING WITH A HURRICANRANA!! SILVA CHARGES AT WARD AND CLOTHESLINES HIM OUT OF THE RING AND WARD HANGS ONTO HIM BRINGING HIM WITH HIM! Diemos is looking outside the ring. He bounces off the ropes and charges… HERE COMES DIEMOS WITH A SUICIDE DIVE LANDING ON DAVIDSON, WARD, AND HIS OWN PARTNER SILVA!! This can’t be good for The Iconomy and Elite is looking down at them in awe of what his tag partner just did. Elite grabs Ripley and sets him up on the top turnbuckle. Ripley is trying to fight right now! He pushes Elite off but he jumps right back up and connects a quick arm drag off the top turnbuckle! Ripley looks like he’s in pain right now and outside the ring Silva is on his feet and drives Davidson right into the edge of the ring then tosses him into the steel ring post!

Rex: Ward has Diemos above his head and drops him straight onto the barricade then connects a jawbreaker to knock Diemos out! Ward walks over to Silva from behind and connects a neckbreaker! Greg Ward is dominating two thirds of The Iconomy outside the ring! Ward is back on his side of the apron with Davidson, Diemos and Silva all trying to get back to their feet outside the ring. Elite connects an elbow drop on Ripley! Elite runs over to Ward and knocks him off the ropes! Elite is going to the top rope now! He could be looking to end this! He looks down at Ripley AND HE JUMPS WITH THE BIONIC STOMP!! WAIT NO RIPLEY MOVES!!! ELITE TURNS AROUND! ELITE DUCKS THE CLOTHESLINE BY RIPLEY AND TURNS HIM AROUND.. BOX OFFICE SMASH!!! IT CONNECTS!! ELITE WITH THE COVER!!!

Ref: ONEEEE!!!!! TWOOOO!!!!!!!!




( “Beast (Southpaw Remix)” by Rob Bailey begins to play as all of The Iconomy get into the ring and has their hands in victory. )

Ring Announcer: Here are you winners… The team of Chris Elite, JJ Silva, and Eclipse Diemos… THEEEE ICONNNOOOMMYYYYYYY!!!!



( An Official hands JJ Silva the microphone and he gets ready to talk with Elite by his side. )

JJ Silva: The Iconomy is meant to be a unit that thrives together. We have grown to work together against all odds and have grown more powerful with time. Diemos was starting to ruin that. Diemos attacked our own this week and for that, he’s done. DIEMOS YOU’RE OUT OF THE ICONOMY!!


Rex: Hang on he’s not done talking!

JJ Silva: Out with the old… in with the new. With Diemos out, we have a spot to fill here in The Iconomy. After this match and doing some scouting, I see only one fit… and he’s standing right here in front of us. Greg Ward, welcome to The Iconomy.

( JJ Silva drops the mic as Elite and Greg Ward join in and all have their hands raised in the air. Camera fades to black shortly after. )

( A series of commercials play for the remainder of the hour until Road to Redemption begins at 7 pm! )


( EAW Intro plays )

( Screen opens up to a vast plain … the camera slowly picks up the pace as the first person view travels through the plain )

( The opening tune of “Line In The Sand” by Linkin Park plays )

( The travel through the plane slows down as the camera tilts upward… it then reveals a great mountain eclipsing the sun. We arrive closer to the mountain, where EAW Elitists and Vixens are climbing up the mountain. )

“Today, we stood on the wall”

( We first see Lucian Black, who is seen scaling the side of the mountain. He grabs a rock to climb further, but it crumbles and the remnants fall down the long slope. He then looks up, laughing despite showing a defeated look on his face. )

“We laughed at the sun”

( Drake Jaeger and Tiberius Jones are seen making their way up the mountain )

“We laughed at the guns”

( Mr. DEDEDE is seen at the plateau of the mountain on his hands and knees heavily fatigued, with recaps of his failures and defeats faintly playing in an overlay in the background. And despite his fatigue, a smile grows on his face. )

“We laughed at it all …”
” And when they …”

( Jamie O’Hara is seen trekking up the mountain )

“They told us to go”

( Several respective shots are shown of Thomas Minns, Mexican and Xavier Williams who are also seen climbing up the mountain )

“We paid them no mind, like any other time, but little did we know.”

( A silhouette of a man can be seen standing over the Showdown Chamber elitists on a mountain ridge, and this man represents the 6th man in the chamber )

( Song jumps ahead as the video transitions to an MV-style format )

“Today, I looked for a sign”

( Footage shows HBB in prayer, along with action shots of HBB and Pizza Boy making it into the chamber )

“With flames in my hands, a line in the sand, between yours and mine”

( Corporate HRDO is seen turning against Zack Crash and Quality Control attacking The Crash Regime. )

“And it came.. like fire from below”

( Action shows show of TLA assaulting Clark Duncan at Shock Value, as well as Clark Duncan attacking TLA on Dynasty on several occasions. )

“Your greed led the call”

( Zack Crash can be seen yelling and sending orders )

“My flag had to fall..”

( The Dynasty Wrestling flag is seen crumpling in Zack Crash’s hands )

“But little did you know…”

( Zack Crash can be seen standing at the summit of the mountain holding out his arms, and the song fades out as the screen fades to black … )

Narrator: AND NOW.

( The guitar portion of “Line In The Sand” picks back up as the Road to Redemption graphical screen appears )



( Camera cuts to the Mercedes Benz Dome where Line In The Sand continues; this time blaring over the speakers and pyro blasts up from the gigantic stage. The raucous crowd are jumping and cheering, waving signs and lights flash all over the arena. )





( is displayed on the titantron to signal the opening match of the night as the crowd goes wild as it’s unexpected from them to have such a match so early with the chamber lowering down to the ring.)

(Video begins to play: It starts by showcasing the reign so far of Brian Daniels: Defeating Tyler Parker and Alex Anderson via submission, surviving structures like Glass Wallz and High Voltage, only to come to his toughest challenge yet… The Elimination Chamber. It also documents the bitter rivalry of Jaywalker and Tyler Parker, going through their feud leading into their Glass Deathmatch, only to have it be renewed in the path to the chamber. Finally, it shows the bad blood that has been emerged between Rhaegar and National Elite Champion Tig Kelly, as they have tried to one-up one another throughout the weeks. All of this and more will be settled, once inside the cruel mistress of The Elimination Chamber.)

Ring Announcer: The following contest is an Elimination Chamber Match… and it is for THE EAW WOOOOOOORRRRRRRLLLLLLDDDDDDDDD HHHEEEEAAAVVVVYYYYYWWWEEIIIIGGHHHHTTTT CHHHAAAAMMMPPPIOOONNNSSHHHHIIPPPPP!!!! Four men will enter their respective pods and two men will start in the ring! The match will start as timed intervals will begin with a new man released from his pod until all six men have entered! The only way to gain elimination is by pinfall or submission! The last man standing will be declared your winner AND YOUR WORLD HEAVYWEIGHT CHAMPION!

(“Spacegrass” by Clutch hits the speakers as Tyler Parker steps out of the curtain to a massive cheer by the crowd as he makes his way towards the chamber.)

Ring Announcer: Introducing first, he is from San Diego, California… weighing in at 213 pounds… “The Face of Dynasty Wrestling” TTTTTTTTTYYYYYYYLLLLLLLLLLLLEEEEEEEEERRRRRRR PPPPPPPPAAAAAAARRRRRRRKKKKKKKEEEEEEEERRRRRRRR!!!

Stew-O: Tyler Parker, a man who has won in this chamber before and became World Heavyweight Champion, now looks to repeat history and claim his spot on top of the mountain as one of the two men to hold that championship three times!

Deadprez: Guess who the other man is, Stew? Y2Impact! The man himself! Tyler wants to bring home the repeat, but in order to do that, he must defeat not only a massive rival, not only the man that took that title from him, but three other men who want that title just as much!

(“Money, Power, Respect” by The L.O.X echoes throughout the Louisiana crowd as their native son, Carlos Rosso, steps out onto the stage with a barrage of cheers from the crowd as he soaks it all in before going towards the chamber.)

Ring Announcer: Making his way to the ring, he is the hometown native of Baton Rouge, Louisiana… he weighs in at 211 pounds… “The Red Angel” CCCCCCAAAAAAAAARRRRRRRLLLLLLLLOOOOOOOOOSSSSSSSSS RRRRRRRROOOOOOOSSSSSSSSSSSSSSOOOOOOOOOOO!!!

Stew-O: This has been the opportunity that Carlos Rosso has craved for ever since he stepped foot in Dynasty Wrestling! He has felt sleighted, felt overlooked, but tonight in his hometown, he could possibly be our next world champion!

Deadprez: I wouldn’t put it pass Carlos! Carlos has been a man who can win in the big show, won in the War Games match and has even gotten victories over some of the men being put in this very chamber, so I don’t see why he won’t be able to do it tonight!

(“Cosmic Sea” by DEATH blasts from the speakers as the thunderous boos from the crowd are booming as Rhaegar paces out of the curtain as he makes his way down the ramp.)

Ring Announcer: Introducing their opponent, he is from Sparta, Greece… weighing in at 220 pounds… “The Spartan Assailant” RRRRRRRRRRHHHHHHHAAAAAAAEEEEEEGGGGGGAAAARRRRRRRRR!!!

Stew-O: The cold icy stare that penetrates through the crowd and even through the chain that binds the Elimination Chamber together, it brings shivers down my spine, Prez!

Deadprez: Yes, but it will take more than some intimidation games to bring these men that stand in the pods to their knees in fear, so he better intend to back it all up in there!

(“Drink The Water” by Justin Cross comes on as a green light basks over the arena while Jaywalker steps out to the stage covered in tribal war paint and dressed in leather armor as he walks with malicious intent towards the chamber.)

Ring Announcer: Making his way to the ring, he is from Gaia… he weighs in at 260 pounds… “The Calamity” JJJJJJJAAAAAAAYYYYYYYYYWWWWWWAAAAALLLLLLLLLKKKKKKEEEEERRRRRR!!!

Deadprez: Now if you want to talk about intimidation, you need to look no further than Jaywalker! He’s the epitome of intimidation and fear! He’s held the World Heavyweight Championship a record four times, has won this very chamber match to hold one, and that was the very one he began his undefeated streak in!

Stew-O: You would be right, as this could be as close as what Jaywalker could call home, because he’s dominated this chamber before and has probably the best chance out of all the contenders to do it again!

(“Step Up (I’m On It)” by Maylene and The Sons of Disaster hits the speakers as Tig Kelly steps out with the National Elite Championship as he taunts to the crowd before entering the ring.)

Ring Announcer: Introducing the man joining the first entry in the chamber, he is from Galway, Ireland… weighing in at 212 pounds… he is the current EAW NATIONAL ELITE CHAMPION… “The Ender” TTTTTTTTIIIIIIIGGGGGGG KKKKKKKKKKEEEEEEEEELLLLLLLLLLLLLLLLYYYYYYYYY!!!

Stew-O: Oh, what a way to kick off the first two men to enter the chamber, since we already know who will join him in the beginning! Tig Kelly, The National Elite Champion, will look to repeat history and etch his name alongside another contender in this match as a dual champion with the National Elite Championship!

Deadprez: This is going to be an unbelievable contest, Stew! All of these men are raring to go as we only have one man left to join into the fray!

(As the crowd slowly simmers down, the lights of the Mercedes-Benz Superdome darken enough to where only the ramp are visible. The entire arena becomes silent, until the loud noise of marching is heard.)

(“The Imperial March” by John Williams plays loudly throughout the stadium… as the song begins to play, two rows of Stormtroopers begin to march down the ramp, holding replica blasters in their hands – as the lights on the stage would lighten up enough to make replicas of AT-ST’s visible on the right side of the stage.)

“I will finish what you started.”

(Following shortly behind the Stormtroopers, with the music still playing loudly… a man dressed as Kylo Ren walks between the two rows, with a replica lightsaber grasped in his right hand… and Darth Vader’s melted mask in his other.)

“I have a bad feeling about this…”

(“The Imperial March” instantly cuts out, as Kylo Ren continues to stand in the middle of the ramp… as “Luke’s Theme/Star Wars Theme” by John Williams plays as the same amount of men and women dressed in Republic clothing, begins to take fire at the Stormtroopers – and the Stormtroopers return fire with their replica laser blasters on the ramp.)

(As the two wage war with one another, a spotlight would then focus on the darkened stage… as the music continues to play, the stage trapdoor opens up as the lift ascends; a man holding a blue replica lightsaber appears, his robes masking his face.)

“Join me… OR DIE.”

(The music suddenly cuts out, as “The Duel of Fates” by John Williams plays straight after – the man removes the robes from his head, revealing to be Brian Daniels underneath. He’d then walk through the war between the Rebels and the Empire, as he meets Kylo Ren.)


(In the midst of the war recital going on behind them, Brian Daniels begins to swing his replica lightsaber at Kylo Ren – Kylo Ren, however goes on to block the continuous aggressive attacks. Kylo Ren would then begin to go on the offensive, flipping and spinning, striking Brian Daniels with everything he has…. until Brian Daniels is able to find one vulnerable spot, takes advantage of the opportunity and strikes Kylo Ren down.)


(“The Duel of Fates” by John Williams continues to play throughout the arena, as Brian Daniels opens his robes to reveal his World Heavyweight Championship strapped around his waist, and wearing Star Wars themed wrestling attire. He walks down the rest of the ramp to the Elimination Chamber, as the war between the Rebels and the Empire ends, with the Rebels coming out on top, celebrating their victory afterward.)

(Ding! Ding! Ding!)

Stew-O: A spectacular entrance for the reigning World Heavyweight Champion as we have a battle of champions before us in Brian Daniels and Tig Kelly, starting off this chamber match! Both men are walking around the ring, eying one another in this staredown to the death, AS THEY RUSH TOWARDS ONE ANOTHER! TIG TAKES ADVANTAGE AND STRIKES WITH THE DROPKICK AND SENDS BRIAN INTO THE CORNER! Tig pulls himself back to his feet as he walks over to the champion STRIKING WITH KICKS TO HIS CHEST AS HE KEEPS HIM WHERE HE’S AT! THE THUDS FROM THE KICKS ARE REMINISCENT TO WHAT BRIAN DOES TO HIS OPPONENTS!





Referee: ONNNEEE!!!…

Stew-O: TIG KELLY KICKS OUT OF THE PIN! Tig rolls on his stomach to prevent another pin attempt as Brian picks himself up from the canvas! Brian turns over and stands above Tig as he pulls him to his feet HOOKING HIS ARMS FROM BEHIND AS HE LIFTS HIM UP! TIGER SUPLEX TO THE CANVAS AS HE HOLDS HIS ARMS DOWN FOR THE PIN!







10… 9… 8… 7… 6… 5… 4… 3… 2… 1… BUZZ!!!

(The pods light up over the competitors as they rapidly spin around the ring, eventually slowing their pace, until they reach… RHAEGAR!!!)


Deadprez: Rhaegar returns his attention back to Brian Daniels as he sees him climbing with the assistance of the turnbuckle corner SPRINTING WITH FULL MOMENTUM AS HE DRIVES HIS SHOULDER INTO THE STOMACH OF BRIAN WITH THE SHOULDER THRUST! Rhaegar pulls himself out as he steps to the center of the ring, taunting against the crowd, AS HE RUNS IN WITH THE CORNER SPLASH THAT SQUEEZES THE LIFE OUT OF HIM! Brian steps out of the corner groggily as Rhaegar rebounds off the ropes DROPPING BRIAN WITH A DISCUS LARIAT AS HE DROPS THE WORLD HEAVYWEIGHT CHAMPION RIGHT THERE IN THE MIDDLE OF THE RING!



Referee: ONNNEEE!!!… TWWWOOO!!


Referee: ONNNEEE!!!… TWWWOOO!!!…

Stew-O: RHAEGAR KICKS OUT AS THAT DIFFERENT USE OF THE PIN ALMOST CAUGHT HIM OFF-GUARD! BRIAN IS PULLING OUT ALL THE STOPS FOR THIS ONE! Tig starts to push his way back to his feet, but Brian runs to the turnbuckle closest to him as he climbs to the top! Tig stands AS BRIAN LEAPS WITH THE DIVING CROSSBODY! TIG CATCHES AS HE DROPS HIM ON HIS KNEE WITH A DEVASTATING GUTBUSTER! Tig rolls Brian off of his knee onto his shoulder AS HE HOOKS THE LEG FOR THE PIN!

Referee: ONNNEEE!!!… TWWWOOO!!!…




Referee: ONNNEEE!!!… TWWWOOO!!!…


10… 9… 8… 7… 6… 5… 4… 3… 2… 1… BUZZ!!!

(The pods light up over the competitors as they rapidly spin around the ring, eventually slowing their pace, until they reach… CARLOS ROSSO!!!)



Referee: ONNNEEE!!!… TWWWOOO!!!…



Stew-O: That floor is relentless! It’s savage! Any person that’s been slammed on that thing will tell you that’s simply worse than the canvas tenfold! Carlos finds his way back to his feet as he turns RIGHT INTO TIG KELLY AS HE DROPS CARLOS DOWN ON THE METAL GRATE FLOOR! HE GRABS HIS LEGS AS HE TURNS HIM TO THE CHAMBER WALL! HE’S GOING TO DO WHAT HE DID TO BRIAN EARLIER ON IN THIS MATCH! SLINGSHOT INTO THE CHAMBER WALL!




Ring Announcer: Carlos Rosso has been eliminated by Tig Kelly!



Referee: ONNNEEE!!!… TWWWOOO!!!…


10… 9… 8… 7… 6… 5… 4… 3… 2.. 1… BUZZ!!!

(The pods light up over the competitors as they rapidly back to back, eventually slowing their pace, until they reach… JAYWALKER!!!)




Referee: ONNNEEEE!!!… TWWWOOO!!!…




Deadprez: JAYWALKER KICKS OUT ONCE MORE! Rhaegar is surprised for a second how quickly he kicked out, but doesn’t let that rattle him as he stands to his feet AS TIG COMES BACK WITH A BACKSTABBER ON RHAEGAR! TIG DRIVES HIS KNEES INTO THE SPINE OF RHAEGAR AS HE COVERS THE SPARTAN ASSAILANT FOR THE ELIMINATION!

Refereee: ONNNEEE!!!… TWWWOOO!!!…



Referee: ONNNEEE!!!… TWWWOOO!!



10… 9… 8… 7… 6… 5… 4… 3… 2… 1… BUZZ!!!

(The pod unlocks as Tyler is able to enter into the match as Jaywalker stands there waiting for him!)


Deadprez: Jaywalker reels back onto the ropes as Tyler STRIKES WITH A LARIAT TO THROW JAYWALKER BACK INTO THE RING! Tyler enters the ring AS RHAEGAR STARTS TO TRY AND RISE UP TO HIS FEET! Tyler is focused on Jaywalker as he starts kicking and stomping on the back of his head ROLLING HIM ON HIS SHOULDERS FOR THE PIN!

Referee: ONNNEEE!!!… TWWWOOO!!




Deadprez: BUT WHAT IS THIS? JAYWALKER ISN’T GOING FOR THE PIN! HE’S OUT FOR BLOOD! Jaywalker lifts up the heap that is called Tyler Parker as he throws him to the outside! Tyler falls on the metal floor as Jaywalker enters the outside as he pulls Tyler back to his feet! Jaywalker lifts him up THROWING HIM INTO THE CHAMBER WALL ONCE AGAIN! Tyler falters back ONLY TO BE THROWN INTO THE CHAMBER WALL ONCE MORE!



Stew-O: Jaywalker lifts Tyler up to his feet and tosses him back into the ring as the broken Tyler Parker limps his way as he tries to push his way back to his feet! This is becoming such a struggle, similar to the situation from House of Glass, as Jaywalker steps back into the ring with devious actions in his mind! Tyler is finally able to reach his feet, almost falling back down once again, as he turns back GETTING DROPPED BY A SECOND CATACLYSMIA TO TOP THIS BEATING OFF AS YOU CAN START TO SEE A TRICKLE OF BLOOD COME FROM THE NOSE OF TYLER PARKER! Jaywalker drops down AND HOOKS THE LEG FOR THE PIN!


Ring Announcer: Tyler Parker has been eliminated by Jaywalker!

Deadprez: THE SHEER DOMINATION OF TYLER PARKER! I HAVEN’T SEEN SOMETHING LIKE THAT DONE AGAINST HIM IN AGES! Jaywalker slowly stands to his feet as he walks to the outside where Tig Kelly is fighting to his feet! Jaywalker has had enough, he’s had his victim in Tyler Parker and now, he wants to end this chamber now! He lifts Tig Kelly up to his feet LIFTING HIM UP AS HE LOOKS TO SECOND SACRIFICE HIM TO THE METAL FLOOR! JAYWALKER WANTS TO MAKE THIS YOUNG MAN JOIN TYLER PARKER IN DEFEAT!





Ring Announcer: Rhaegar has been eliminated by Tig Kelly!



Referee: ONNNEEE!!!… TWWWOOO!!!…




Ring Announcer: Tig Kelly has been eliminated by Jaywalker!




Referee: ONNNEEE!!!… TWWWOOO!!!…

Stew-O: JAYWALKER KICKS OUT OF THE PIN! THERE’S STILL A BIT IN THE TANK FOR JAYWALKER TO KEEP GOING, BRIAN! Brian looks at the referee to make sure as the referee tells him he kicked out, as Brian slumps over to the corner TAUNTING FOR THE VALAR MORGHULIS! Jaywalker is pushing himself back to his feet, fighting up as Brian just wants to knee his head off his shoulders, as he turns BRIAN RUNS IN FOR THE KILL! JAYWALKER GRABS HIM RIGHT BY THE THROAT AS HE BURNS A HOLE RIGHT IN HIS FACE! JAYWALKER LIFTS HIM UP! CHOKEBOMB RIGHT IN THE MIDDLE OF THE RING!!!! VERACITY!!!!!! THE LEGENDARY FINISHING MANEUVER OF JAYWALKER’S CONNECTS!!! JAYWALKER HOLDS HIM THERE FOR THE PIN!





Deadprez: Brian reaches for the hand as he tries to pry him off with his fingers, looking to try and escape his doom from this hold, AS HE FINALLY PRIES HIM OFF AND SCRAMBLES OVER TO THE CORNER AS JAYWALKER LIES ON THE CANVAS AS BOTH MEN ARE CATCHING THEIR BREATHS! Brian lies back in a seated position, staring directly at a fallen Jaywalker, as both men have been taken to hell and back to secure the World Heavyweight Championship.

Stew-O: Jaywalker looks beaten and battered like Brian in the corner, as what can these men do to end this match? OH MAH GAWD! JAYWALKER JUST ROSE UP IN A SEATED POSITION LIKE HE JUST ROSE FROM THE DEAD! He turns to stare right at Brian AS BRIAN LOOKS IRRITATED BY THIS, MOUTHING SOMETHING LIKE “ARE YOU KIDDING ME?” Brian brings himself up to his feet as Jaywalker jumps to his! Jaywalker rushes in AS BRIAN COMES IN WITH THE CAUSTIC ECHO!



Stew-O: BRIAN DANIELS POPS THE SHOULDER UP AT THE LAST POSSIBLE SECOND AS JAYWALKER SLAMS HIS HANDS TO THE MAT IN FRUSTRATION! I THOUGHT THAT WAS IT, PREZ! I THOUGHT WE HAD A NEW WORLD HEAVYWEIGHT CHAMPION RIGHT THERE! Jaywalker pushes himself up to his feet as he calls for Brian to get to his feet DESPERATE TO HIT HIM WITH THE CATACLYSMIA! Brian fights to his feet, trying to pick himself up after such a devastating maneuver from The Calamity, but with the will and determination of a champion HE’S ABLE TO STAND!



(Ding! Ding! Ding!)

(“Dragonborn” by Jeremy Soule plays in the background as the beaten and battered Brian Daniels uses the ropes to climb his way back to his feet as he’s handed the EAW World Heavyweight Championship.)



Deadprez: It ended up with him and Jaywalker and it was anyone’s match during that encounter, but Brian snuck out the Caustic Echo at the last second and was able to get the three-count from it!

Stew-O: What a match! I’m still in awe of the match we just witnessed! Brian Daniels winning the chamber as the first entry is just… well… INSANE!

(Brian Daniels walks out of the chamber and makes his way to the crowd, celebrating with this in this most-deserved victory as he scales the Elimination Chamber before taunting to the crowd as he holds the EAW World Heavyweight Championship in his hand for all to see.)

( Camera fades backstage, where we find Showdown General Manager James Shields in his office, as he is continuing to talk on the phone… )

“Jesus christ. It shouldn’t be THAT hard to find a connecting flight to San Antonio next weekend… Of course this is mandatory, it is BUSINESS related. I had to pull SO many strings, just for the sake of this one guy, so when I tell him I DON’T EVEN HAVE A SEAT FOR HIM TO GET IN THE PLANE, JUST TO GET HIS ASS TO EAW PROGRAMMING.

( A knock is heard on the door, as they welcome themselves into the room… Athena Lannister. )

“Alright, I don’t have time for this. Get it together!”

( James Shields throws down his cell phone, as he heads his attention towards Athena. )

James: Damn Southwest. What can I do for you?

Athena: I won’t take much of your time. I come with a request. From King Lannister.

James: I can only imagine what your husband wants. Alright, shoot away.

Athena: Well, it’s rather simple, actually. King Lannister only wants his match later tonight to be a No Disqualification match.

James: That seems rather fishy, don’t you think? This is for the crown, after all. And you wish to make this extreme rules… and I have an odd feeling that this could get sketchy, real quick. And your involvement will be imminent. I will have to deny this request…

Athena: I dare tell you —

James: No. No you know what, fine. You can have your Extreme Rules. EAW’s rights are up in the air anyway. Might not get punished for allowing it. However, I have one stipulation to add to this. If you get involved, come in contact with Matt Miles whatso EVER… Lannister WILL forfeit his crown. And this is the only wa–

Athena: Fine. Consider that done. You think Lannister needs me to handle his battles for him? You must not understand what’s on the line. But I am glad all the same to see your willingness to comply. I do however, one more favor… and this, this one is in regards to the Elimination Chamber.

James: Do tell.

Athena: This requires… a bit of, explaining.

( Camera slowly fades back to ringside, as the audience is left in the dark… )

Ring Announcer: The following contest is scheduled for one fall….AND IS FOR THE NEW BREED CHAMPIONSHIP!!!!!

(“Anything” by Hedley starts to play as Clark Duncan comes out with a look of determination. He has on a red jacket with the hood over his head, looking down while he goes down the ramp and ignoring everything around him, instead shadow boxing as he makes his way to the ring.)

Ring Announcer: Introducing first, from Chicago, Illinois….weighing in at 233 pounds….he is The Head Manager of Voltage Relations and Zack Crash’s executive assistant, as well as the SELF PROFESSED NEW BREED CHAMPION……CLAAAAARRRKKK DUNCAAAAANNNNN!!!!!!!!!!

Eddie Mack: Tonight might be the most pivotal night in Clark Duncan’s career, may be even his entire life! Clark Duncan’s rookie year in EAW has been filled with many bumps in the road but here has been presented with one more opportunity to end it on a high note, to make his troubles all worth it!

Kawajai: Clark Duncan is not going to let this opportunity pass him by. I have never seen him more passionate about something, we’re so used to seeing Clark be that laid back kind of guy but ever since last month everything has changed! He wants that New Breed championship more than anything, he thinks he deserves it more than TLA and plans on proving it with his actions in the ring!

(“Intro” by DMX blasts through the speakers as TLA walks out to a very vocal crowd, the Dynasty fans cheering him on while the notable pro-EAW fans are hesitant to cheer. He pats the New Breed Championship that is around his waist before walking up the steps and entering the ring.)

Ring Announcer: And his opponent, from Tlaxcala, Mexico… weighing in at 240 pounds… he is EAW NEEEEEEEWWWWWWW BRRRRRREEEEEEEEEEDDDDD CHHHHHAAAMMMMPPPPIIIOOOONNNN… “La Pantera Sexual” T…..L…….AAAAAAAA!!!

Eddie Mack: The divide in the crowd becomes even more obvious as even a fan favorite like TLA is getting a little push back. That only helps highlight what this whole feud has been based around : the war going on between Dynasty and EAW. Both men are looking to represent their organization well, and with the ending being near as we get closer to that all or nothing Chamber, the momentum Dynasty could have by keeping the New Breed title in its camp is pretty huge!

Kawajai: Keep in mind it’s not just that which has driven this rivalry, it is the disrespect TLA has had to experience from The Crash Regime! They want to question the legitimacy of his reign, they want to call him a glorified comedian and that is something TLA will not stand for after how hard he’s worked to be champion. He will not let their claims carry on any longer and looks to silence the detractors once and for all!

(Ding! Ding! Ding!)

Eddie Mack: The bell rings and these two erupt right out of their corners! Clark charges right at TLA but TLA goes low and picks the legs, grabbing hold of it before engaging in a takedown! TLA wants to go to blows but Clark flips him over onto his back and tries to press those shoulders of his down for a quick cover! TLA gets the shoulder up before the referee can get in position but when he does, Clark cracks him in the back of his head with an elbow and then turns him onto his stomach! Clark pulls his head up thanks to a handful of hair and smashes his mouth in with forearms across the face to soften him up! TLA momentarily stops struggling and Clark sees that as his chance to lock him into a camel clutch! Clark reeling back on that submission hold, Clark already has our Champion in a bad spot, displaying great technical prowess! TLA has regained his sense of awareness and starts pulling at the boots of Clark, he’s doing his best to shake out of the clutch! He gets a good grasp of the feet of Clark, he’s pulling himself up with Clark Duncan still on his back! TLA walks backward into the corner, letting Clark go spine first into the turnbuckles!

Kawajai: TLA drops down on one knee, sputtering and tired from that exhausting hold! Clark Duncan gets back up onto his feet, he’s favoring his back but ready to leave the corner — until TLA turns back to Clark and hits an enzuigiri! Clark Duncan is in a daze….he falls straight onto the mat! TLA wants to turn him over in order to capitalize, but when he rolls him over Clark doesn’t stop, he’s heading to the apron to escape! TLA grabs him by the strap of his singlet before he can leave and wishes to drag him back in the ring but Clark Duncan drapes his arm around TLA and drops him throat first into the ropes in a variation of the stunner! TLA staggers to the middle of the ring as Clark Duncan stays on the apron and then climbs up to the top rope! It’s too late for TLA to look up and move out of the way, Clark Duncan leaps off for a flying axehandle! TLA is hurting, he tries to get to all fours and crawl off for some distance but Clark Duncan is the more alert of the two and does a running punt kick right to the gut!

Eddie Mack: Clark goes against the ropes looking for a follow up! Dropkick to TLA, he can’t even get to his feet without Clark there to stop him! Clark Duncan gets another running start from the ropes, this time for a back senton but TLA gets the knees up! More damage to the back! Clark Duncan is on his feet but is then placed in a cravat! He’s tossed overhead by TLA, lands on his tailbone and is hit by a roundhouse! Spoke too soon there, Clark ducks it — only to be nailed with a double footstomp to the chest! The tip of the boot may have got him in the jaw there as well! TLA doesn’t waste any time, he scurries over to Clark’s body and covers!

Referee: ONEEEE!!!….TWOOOO!!!…..

Kawajai: Clark Duncan powers out of it! He pushed TLA right off and sat up, gasping for air after all of it was taken out of him from that stomp! TLA comes back to him and directs traffic, he guides him to his feet in waist lock. He looks for a German suplex but Clark is fighting it and keeping himself on a vertical base. Clark is a few feet off of the ground before he weighs himself back down! Change of plans here as he is spun around by the arm like a rip cord and takes a Cartel kick to the temple! TLA slides around the mat to get behind Clark and again goes for a suplex, not a German this time though! THE PANTHERPLEX! Clark Duncan senses the danger and goes right under the bottom rope after to take a walk! TLA isn’t going to let him walk away though, he goes to the side of the ring opposite to Clark and waits for Clark to come full circle!

Eddie Mack: Clark is too concerned with his injuries to notice as TLA intercepts with a clothesline! Clark Duncan hit the concrete HARD there! He shakes the cobwebs and as he does, TLA is lying in wait! TLA pounces on him, sending him right into the steel steps! TLA is bringing the brutality and looks to continue it by backing away for some momentum! Clark is still up against the steps, TLA is coming right for him! Running knee by TLA! It’s countered though! Clark Duncan shows some life by doing a back body drop to stop it! TLA lands on his feet on the other side to save himself!

Kawajai: That won’t help TLA much in the long run! Clark sends a boot to steps, causing them to ram right into his opponent! He slides back into the ring just to come sliding out where TLA is and grabs him by the hair — CLARK DUNCAN TOSSES TLA INTO THE BARRICADE AT FULL SPEED! THE CROWD RESTRAINT SHOOK FROM THE IMPACT! Clark Duncan won’t even stop there, he’s stomping on TLA! He’s a man obsessed, he wants to beat the life out of TLA! The referee is trying to be a bit lenient with his count due to the important nature of this match but he is getting tired of these antics. He starts up the count but has to restart right as he begins because Clark rolls in to stop it! Clark Duncan is being warned about his excessive aggression right now but he’s ignoring the lecture! All he’s doing is leaning over the ropes, watching TLA with intent! TLA hangs onto the barricade to stand firm and once he’s recovered he walks over to the ring, but a baseball slide stops him from getting back in!

Eddie Mack: Clark Duncan grabs the ropes and jumps over to the apron! He turns his head to look at TLA, he is still shaken! Clark knows the coast is clear, he springboards off of the rope! MOONSAULT! CLARK DUNCAN CAME CRASHING DOWN ON THE CROWN OF TLA’S HEAD! TLA collapses on the floor in a heap, Clark now has to carry the dead weight of his body and try to pull him back in! A move like that could have broken TLA’s neck, let’s hope he was ok after that! Clark Duncan shoves TLA into the ring and scrapes TLA off the ground! He gets him in position….CRADLE DDT!!! Clark Duncan zeroed in on the possibly damaged neck of his! He turns TLA over after that and hooks the leg, this might be it!

Referee: ONEEEEE!!!…..TWOOOOOO!!!…. THR —

Kawajai: TLA kicks out and his championship reign stays alive for the time being! Clark Duncan wipes the sweat away from his eyes and starts to reflect, pondering on what he needs to do to put TLA down for good! He stands back and observes TLA, there’s not much motion coming from him. That kick out must have been instinct, it was all TLA might have had left! He reaches out to the ropes and struggles to scale them, slowly but surely he is succeeding to get back to his feet! TLA pushes himself away from the ropes and swings with all of his might! Clark evades the blow and hits him in the gut, forcing TLA to kneel over as he is then pulled onto his shoulders! Clark is going around and around while holding TLA, airplane spin! Clark is showing no signs of stopping with those rotations, he’s getting TLA as dazed as he can — but TLA spins out of it on that last rotation!

Eddie Mack: TLA lands behind the back of Clark Duncan! European Uppercut by Clark but it’s blocked and TLA spins him around so they’re back to back! He hooks the arms of Clark and lifts him up in a crucifix! The gory bomb! Clark was slammed face first against the canvas! TLA is staying on him, he takes Clark and physically hangs him onto the middle rope! TLA has him set up, going for the 305! The Tiger Feint kick across the face! Clark Duncan passes out and is launched off the ropes onto his back! TLA is looking around, almost in disbelief! He’s gripping the ropes tightly, the crowd wants him to go for something big and knowing TLA, he will comply with it! TLA’s going to finish it — SPRINGBOARD METEORA!! THE GALLOWS!!!!!

Kawajai: Clark Duncan moves out of the way at the last second! TLA is being left to crash and burn in a nasty fall! TLA is able to get up under his own power but is unable to see Clark Duncan coming! Fisherman buster by Clark, wait, no! TLA drives his knee into Clark’s skull to get him to loosen his grip and let go! TLA makes a smooth transition as soon as he’s back on his feet, bringing Clark Duncan down right into the reverse bulldog! You’re Done! TLA hit that as powerfully as he could! That adrenaline rush of his is beginning to fade away, he’s feeling the wear and tear this match-up has caused him! He stirs and drags himself to Clark Duncan, getting on top of him! TLA may be able to add another successful defense to his resume!

Referee: ONEEEEE!!!!….TWOOOO!!!….THREEEE —

Eddie Mack: Clark Duncan feebly presses forward, he barely saved this match! TLA and him are both down and absolutely spent, it’s been pedal to the metal since this match has started! TLA is winning the race to get their feet it seems, he tilts his head up and looks at all the Dy-Hards in the audience, willing him on! TLA is able to dig deep and get back up! Clark Duncan is in his sights! He spots Clark beginning to rise and blindsides him! Rolling neckbreaker! Clark Duncan shoves him off and into the ropes! TLA comes back for a spinning heel kick, taking him off of his feet and onto his knees! TLA sees his opening and chimes in with a superkick that could be heard throughout the arena! Clark Duncan may have been sent into unconsciousness with that, why isn’t TLA going for the cover?

Kawajai: He’s getting paranoid here, he has been put to the test by Clark and doesn’t want to risk him making a comeback! TLA is winding it up and preparing himself even more than before! He’s looking for a game ender here, he wants to make sure there’s no chance in hell of Clark Duncan kicking out! Clark Duncan is pushing himself off the mat but I don’t think he even knows where he is! He finally looks and sees TLA beside him but when he does TLA comes in with his second superkick! CLARK CATCHES IT! Clark has the foot and is leaving TLA in a bad position! Clark grabs the other leg and now has TLA up in position for a powerbomb! OH! That back of his is starting to give out, it’s been worked on multiple times and it’s making it hard for him to keep TLA up in the air! TLA understands what is going on now, he’s gotta knock him down! A punch in the face is what does Clark in and drops him!

Eddie Mack: TLA has cut him down! He falls down on Clark and…wait a minute! TLA is going for THE CROSSED PATHS!!!! AND HE GOT IT!! TLA has locked in the Crossed Paths and is wrenching that thing in with as much energy as he can! Clark Duncan has nowhere to go, TLA has him in the center of the ring! Clark Duncan is prying TLA off of him but TLA just smashes his legs against his nose and goes back to yanking that arm! Clark Duncan is experiencing nothing but pure agony, his arm could be close from being pulled out of its socket! He must tap, but I don’t think his pride will let him, Clark is about to go out swinging! You’ve got to wonder if Duncan might just call it a match so he can at least have something left for his Elimination Chamber match at the headline of the show! Clark is sucking it up, he’s containing the pain he’s feeling and is powering through — but TLA maintains control once again! Clark has been grounded and TLA is pulling that arm back, he’s going to break it if he has to! Clark Duncan is fidgeting his hand around, he must be considering the idea of submitting! It’s only a few inches away from the mat, all he has to do is tap out and this is over! Clark Duncan takes that hand — and places it back on the legs of TLA! He’s trying to turn TLA over, lifting up his legs and placing him on his back! The element of surprise may have worked out there, TLA was not at all expecting that! TLA refuses to let go of the armbar but it might not be very effective with the position he’s in! He’s forced to look up at Clark who raises his free hand up high so he can rear back for one shot right to the bridge of the nose! TLA eases off and is forced to let go! Clark Duncan has broken free, he needs to jump on this!

Kawajai: He is, Clark is kicking it into high gear! He’s scooping TLA off the mat and placing him in a fireman’s carry! TLA is firing back with as many elbows as he possibly can to get out of it but Clark is doing his best to keep him over his shoulders. Clark Duncan is looking at the corner, that can only mean one thing! THE PUNCHLINE!!!!! TLA HAS BEEN DROPPED BACK FIRST ONTO THE TURNBUCKLES! He almost falls to the outside but Clark is quick to hold onto his body, he is not letting him get away! He’s dragging TLA off of the top turnbuckle with a double underhook and then brings his almost limp body to the center of the ring! HE’S LIFTING HIM UP! Clark Duncan has him in overhead position, could this be…. THE LAST LAUGH! THE GUTWRENCH RACK DROP! TLA HAS BEEN HIT WITH THE LAST LAUGH AND AS SOON AS IT HITS CLARK DROPS DOWN AND HOOKS BOTH LEGS!

Referee: ONEEEE!!!….TWOOOOO!!!….THREEEEE!!!!!

(Ding! Ding! Ding!)

(“Anything” by Hedley plays as Clark Duncan rolls off of TLA, not even able to get up. The referee takes the championship from the timekeeper’s area and drops it on the chest of Clark, who immediately clutches onto it and then rolls out of the ring, staggering over to the barricade and celebrating with some of his fans.)

Ring Announcer: Here is your winner….AND NEEEWWW NEW BREED CHAMPION…..CLAARRRKKK DUNCAAANNNN!!!!!!!!!!!!!!!

Eddie Mack: Clark Duncan did it, he actually did it, he has become New Breed Champion in amazing fashion! I don’t know how he did it but he managed to find a second wind and was able to do something I didn’t think he could by breaking through the Crossed Paths! Tonight Clark Duncan would not be denied, even with the pain in his back he had enough left for that final flurry and to deliver The Last Laugh to end this! Make no mistake about it though, TLA put up a great fight. That was a damn good performance.

Kawajai: It really was, not even Clark Duncan can deny as he looks across at TLA with different eyes after that match. Clark Duncan has to admit it, TLA is as legitimate as they come and pushed him to his absolute limit there! What a match and what a moment this has been. Clark Duncan first joined at the start of the year and ever since then he has always come up short, he has always been told he couldn’t do it! Clark has went against the grain and proved all of those doubters wrong. In one match he has shown he has belong, that he can wrestle with the best of them, that he can be…CHAMPION!

Eddie Mack: You can bet Zack Crash is happy about this!

(Clark Duncan walks up to the stage and raises the New Breed Championship up high as even the fans who were skeptical from his recent behavior can’t help but join in on the reaction.)

( Camera cuts backstage to Eve who is standing in the interview area with a microphone in hand )

Eve: Good evening ladies and gentlemen, standing backstage with me now is the self professed “Vixens Killer” and the former EAW Vixens Champion, TARAH NOVA!

( Tarah Nova waltzes on to the screen and plays with Eve’s hair )

Tarah Nova: Hai, Eve! 😀

Eve: Tarah, prior to last week’s episode of Dynasty Wrestling you hadn’t been seen in well over two months ever since you were defeated by Madison Kaline for the Vixens Championship. What was the reason for this hiatus?

Tarah: Oh God Eve, does that even matter? I wasn’t here, now I’m here!

Eve: Right, well you sure made your return in an emphatic way and also at the expense of Madison Kaline when you interfered in the Extreme Rules Vixens Championship match on Dynasty and viciously assaulted her. Can you describe your feelings for Madison Kaline, and how do you believe Maddie will respond to your attack?

Tarah: I don’t have feelings for Madison at all. I’m woman enough to admit she got one over on me, but did she really think it wasn’t going to come with a receipt? Does she not know who I am?? I am the VIXENS KILLER. I eat little brats like her for breakfast. As for how she respond, I know she isn’t going to take what I did to her well. Chances are she’s probably got some major issue with me now and she’s going to stumble right into my trap. Fine and good, I would absolutely love to ride the wave back to my Vixens Championship… and if it means derailing Madison Kanine’s little crazy train off of it’s track, then so be i–

( SUDDENLY: MADISON KALINE ASSAULTS TARAH WITH A FOREARM! Madison assaults Tarah with a hammering of fists while Tarah is barely able to protect herself. )

( Madison rips Tarah off of the ground, but Tarah tackles her to the floor and the two roll around in a scrap fight throwing everything they have at each other in terms of punches and slaps. )

( Tarah gets the upper hand and Madison retreats before Tarah comes after her — but Madison grabs Tarah and throws her over a production table. Tarah gets back up, but Madison grabs lighting equipment for the interview area and SMASHES A SET OF LIGHTS OVER TARAH NOVA’S HEAD! )

( Madison grabs Tarah and throws her through the backdrop of the interview area, and Madison hovers over her on the ground beating her relentlessly with fists until a swarm of officials come and rip Maddie away from Tarah. )


( Madison is dragged away from the area and officials are surrounding a bloodied Tarah Nova, who’s on the ground with a smile on her face as blood runs down her face and the scene comes to an end. )

( Show returns to the arena )

( A highlight package commences, as the lights dim in the arena. The tune of “Hands on the Bible” by Local H fills the arena…

“Hands on the bible… scared like a child.”

( Highlight of Matt Miles being taken out by House Vendetta, with no sight of help from his RAGNAROK brethren… as the highlight of Lannister announcing he is cashing in his King of Elite contract at the Showdown Supershow. )

“God holds you liable… For what you’ve done.”

( Highlight of Lannister being laid out before his EAW Championship match, before transitioning Matt Miles to revealing himself as the culprit. )

“Stare down your idols… A pretty baby, never born.”

( Highlight of Lannister being helped with medical attention, as Matt Miles cashes in his 24/7 contract to compete for the EAW Championship. )

“You can’t believe it… You didn’t mean it…”

( Highlight of a flashback of Lannister announcing Aren Mstislav and Matt Miles as his new members of RAGNAROK, then shifting to Lannister’s shock of learning of his culprit. )

“But they saw you do it… and they KNOW YOUR NAME!”

( Various highlights of Matt Miles laughing, followed up by in-ring work where he has the upper-hand on his opponent,)

“Hands on the bible…. EGOMANIACAL!”

( Highlight shifting to a scene of Lannister holding onto the ropes to get to his feet, looking downward the entrance ramp in furious anger. )

“As your screw yourself into oblivion… Worn and faded… )

( Highlight of Matt Miles and Lannister staring down, and Lannister putting his King of Elite crown on the line just to get his hands on Miles. )

“You’ll have to face it… ON YOUR OWN.” )

( Highlight of Lannister and Miles finally beginning to brawl, leading up to Road to Redemption. )

“Smashed in the pavement… Stunned in amazement.”

(Highlight of Miles gaining the upperhand, only for Lannister to throw Miles over the top rope. And Miles teasing of getting back into the ring, only to draw back and pointing towards Lannister, shouting for his crown. )

“Everything you make…”

( Highlight shifts to Lannister looking down at his King of Elite crown, and Matt Miles taunting as if he’s putting one on, as they stare down…”

“COMES CRAWLING BACK TO YOU!” with the highlight ending, and the arena lights up once more, and the bell rings three times. )


Ring Announcer: The following contest is scheduled for one fall… And it has just been confirmed. IT WILL BE CONTESTED UNDER… NO DISQUALIFICATION RULES!

( The crowd gives a loud pop at the surprise, as the camera angle shifts to the floor of the entrance ramp, as the first challenger is awaited for. )

(“Take Out the Gunman” by Chevelle plays as Matt Miles emerges through the curtain all hyped up, yelling at the camera “WOOOOO! LET’S PLAY CHESS WITH KINGS AND QUEENS!” as he energetically makes his way down the entrance ramp, bobbing his head to the tune of his theme. )

RA: Introducing first… the challenger, from San Diego, California… weighing in at 221 pounds… THE MIDAS TOUCH, THE RED… MATTTTTTT MILESSSSSSSSSSSS!!!!!!

Mercer: I must say, nobody has ever looked so confident going into a match, when facing King Lannister. He doesn’t seem phased, he doesn’t even feel threatened. Are we looking at the new monarch?

Ryder: Hell no! Miles is full of himself, if I say so myself. He sees this as a game. He thinks just ANYONE can defy King Lannister and live to tell the tale. Lannister is going to mop the floor with this traitor, just like he did with Norman Hellion. You think it’s a coincidence Lannister had Athena turn this into an Extreme rules match? I don’t! He’s going to pay for what he’s done.

Mercer: Your faith in Lannister has been warranted, but perhaps Miles defied a man he saw as weak. He’s been playing fiddle with Lannister the past few weeks now. He took him out of the EAW Championship match at the Supershow, and now he’s gotten Lannister so caught up in his own anger, he’s convinced him to put that crown on the line. Lannister hasn’t been the same reckoning force lately, and now is the time to attack.

( Camera shifts to Matt Miles eagerly waiting for Lannister instead the ring, as he holds down the ropes while crouching, getting loose for the man they call… )

( “Shepherd of Fire” by Avenged Sevenfold plays as King Lannister methodically, slowly walks through that curtain, with Athena Lannister flanking his side. Lannister and the queen walk down the ramp, hand-and-hand, as the two circle the ring, staring down Matt Miles, as Lannister slides off his kingly robe, and hands Athena his crown. )


Ryder: And here comes the KING himself! All hail, all hail the majesty. Here lies a man that epitomizes strength, power… all things that Matt Miles wishes he could represent. This is a man that put Matt Miles under his wing, took him to the promised land when nobody else would even bat an eye for him. And he was betrayed. The King’s justice will be on full display here tonight.

Mercer: You forgot to mention that King Lannister did absolutely NOTHING to help Matt Miles when he was being assaulted by the entire legion of House Vendetta. A man he swore to protect, he forgot to take care of his own. Matt Miles has much reason to be bitter. The forgotten son Miles claims, and he is right in every sense of the word. King Lannister’s pride has always been shortsighted and selfish… and good for Matt Miles to try to take what is his.

Ryder: Lannister took him under his wing! He was the HEIR APPARENT, Lannister’s own words. He wanted the crown for himself, that selfish, leeching no good traitor. He has earned himself a traitor’s death after tonight. You do not DEFY Lannister. You do not TEMPT Lannister. Look at Norman Hellion. GONE. Look at Ares Vendetta. BROKEN. And tonight, Matt Miles is going to meet the same fate. But worse. For what he’s done… he won’t face his own demons. He’ll be meeting the Angel of Debt. And there is a price to be paid, to the crown.

( The camera pans to the center of the ring, where Lannister and Matt Miles stand on opposite sides of the ring, as the referee holds the Crown up in the center of the ring… )

( Ding! Ding! Ding! )





Ryder: That didn’t take long… as all Lannister can do is look at Matt Miles lifeless body. I told you this was the fate of a traitor! Pure domination! Matt Miles’ aggression gets the better of him once more. Lannister is the definition of precision… he knew what was coming. But will Matt Miles SEE WHAT’S COMING TO HIM! ATHENA HANDS LANNISTER A STEEL CHAIR, REMEMBER THIS IS ALLOWED! AND BAH GAWD, LANNISTER STARTS HAMMERING AWAY SHOTS AT THE BACK OF MILES NECK! TIME AND TIME AGAIN! We saw Miles grabbing for his neck earlier, and Lannister must have saw it! Because he surely continues to TARGET it! That chair is battered, bent… any adjective you can think of! Lannister just WAILS it to the side, knowing he can’t get any more damage out of it, it’s practically bent in half! Just LOOK at Lannister’s face, he’s boiling with frustration! He’s pacing around Miles. I’m not sure Matt Miles knew he was getting himself into.


Mercer: Miles waves his arms around, trying to reach for anything to help him up… but all he can grab at are Lannister’s feet. Which Lannister just kicks him away, knocking him back into the ring to the point he’s sitting up. AND LANNISTER RUNS AT HIM WITH A HIGH KNEE! THIS IS BECOMING VERY ONE SIDED. As Lannister just throws Miles body back into the ring… but he doesn’t seem intent on following. What does Lannister have in mind here?! He’s bringing a table into the fold! And he throws it into the ring. BUT HE’S NOT DONE…AS HE GRABS A STRAND OF BARBWIRE! LANNISTER SETS UP THE TABLE, AND LAYS THE BARBWIRE ON TOP… MATT MILES CAN’T ESCAPE NOW! LANNISTER SETS HIM ON HIS SHOULDERS… THE BROKEN CROWN!!!!!!!!!! BORDER TOSS!!!!! THROUGH THE TABLE! BAH GAWD!



Mercer: What?!

What is Athena doing… she just got the attention of Lannister, and he broke up his own pin!

Athena: This is no traitor’s death. Not until he can’t get up anymore. FOR THE CROWN!






( Matt Miles, with blood gushing from his nose, slowly grabs for the ropes, but can’t even lift his head up. He tries to use the ropes as leverage, but that’s all the further he can go. )





Lannister: Lannister WILL be the last thing you ever see. Athena, MY CROWN.

( Lannister is thrown his crown by Athena, as he starts bashing it into Matt Miles face, to further the bloody mess. )


( Lannister places the King of Elite crown on Matt Miles, as he lifts his body up once more. )






( “Shepherd of Fire” echoes throughout the arena, as everyone is still left speechless, in shock and awe. )

Ryder: You could hear a pin drop in here… As the paramedics swarm down the entrance ramp, and Matt Miles is being attended to. Just pure dominance here tonight, sheer determination to send a message to the rest of EAW, of what happens when you try to oppose King Lannister’s rule. King Lannister got his retribution… and Matt Miles have just paid for it all with his career. He might have a broken neck here. He’s had multiple surgeries in the past few years as is… and I do NOT like the way he landed on it.

( The camera goes split-screen to show the replay of Lannister hitting his debuting Red Wedding (Judgment Slam) from the top rope, as Matt Miles and Lannister both crumble to the outside concrete floor, but with Matt Miles landing on his neck. )

Mercer: They’re calling for the stretcher… Just the look on these paramedics faces are worrying me. This is a travesty, that the referee let this match go on this long. It may cost this individual his career. This doesn’t look promising. Lannister definitely got what he wanted out of this, and why would anyone want to cater to his needs. What a cruel, diabolical man he proved to be tonight. Savaged dog with no moral ground to step on.

Ryder: That is YOUR King you are speaking about, Jakehole. And you best not forget it. This is the REIGN of King Lannister, and tonight of all nights, you best not forget it. Matt Miles earned this price tonight, for what he did to Lannister at the Supershow. You better bet somebody in the back will think twice before trying to defy Lannister again. Ask Ares. Ask Matt Miles. This was a slaughter.


( Lannister hovers over Matt Miles, as he just stares down the body without movement. Muttering the words “For House Lannister.” as Athena joins him in seeing the carnage displayed, until finally a sequence of security finally separate him from the scene. Lannister does not resist, for he recovers his broken crown from the floor, and tries his best to place it on top of his head as “The Rains of Castamere” play through the crowd. )

Ryder: I… I can’t describe anything. I’m at a loss of words. For the love of it all, send this back somewhere. We’ll be back from ringside…

( Camera slowly fades as the final splitting image is Matt Miles on the ground, and the audio picking up paramedics “I don’t think he can move!”, until finally fading elsewhere. )

( KOE Commercial featuring the song “Kings Never Die” by Eminem )

(The camera transitions towards the backstage area, as several EAW Elitists and Vixens are crowded near a table, filled with festivities and refreshments.)

???: Ladies and gentlemen…….it is truly a joyous season for us all….

(Ashten Cross slowly emerges towards the crowded group of people, as he raises a glass filled with wine up in the air.)

Ashten: It gives me great honor for me to arrange this small banquet for everyone here in attendance. It has been a CRAZY 2015 for virtually almost every wrestler in this company, as they have gone through torment and hell to get to where they are today. It is moments like these that makes me appreciate each and everyone even more.

(A roar of applause can be heard everywhere, as Ashten Cross smirks while drinking his wine.)

Ashten: I would like to formally…wait….

(Several objects are thrown at the general direction of everyone, as they appear to be red balls with a piece of rope attached on top.)


(A swarm of Elitists and Vixens all look around petrified, as several balls continue to drop all across the floor.)

Ashten (talking on his phone): THIS IS CODE RED, I REPEAT….THIS IS CODE RED! Th—

(Ashten looks across the hall in shock, as a group starts to advance towards everyone, They all are wearing green hoods along with green pants, as Ashten tosses his black suitjacket across the floor, putting both fists in the air.)

???: The moment the world has all been waiting for….

(The individuals both raise their hands to grab the top of their hoods, as Ashten continues to stare down menacingly. They all simultaneously take off their hoods, revealing their faces.)


(The group is revealed to be Venom and El Landerson as they all start to groove in motion.)

El Landerson: I am sorry Mister Ashten Cross, we arrived at EAW wrestling with our hoodies because DCW and me, me as in El Landerson, have something to tell you to your faces. After that, I would wont to be inserted into the Answers World Championship match for the Road towards Redemption Free Per View live babay!

Ashten: What the hell do you people want?! Get the–

( Team DCW digs down into their pockets, and they all throw a bunch of coal directly at Ashten Cross, as his white-sleeved shirt is stained with black residue.)

El Landerson (while throwing): WE………..

Venom (while throwing): WANT………………..

El Landerson (while throwing): Mister Ashten Cross, Team DCW would want…..

Landerson and Venom: JUSTICE!

El Landerson: Yes, we would want justice right now on this Free Per View.

Venom: The reason why we are dressed up as elves, is because of the fact the Board are not people that intend on giving opportunities to their……..their………………taleeeeeeeeeeeents *HICCUP*…..

(A drunken Venom tilts back and forth, as El Landerson places his hand on his shoulder.)

El Landerson: Yes, come on Ashten Cross of EAW, you are much better than this please sir, kind sir….

Ashten Cross: What in the bloody hell…..

(Several footsteps can be heard within the distance as well as sleigh bells, as Team DCW turn their backs around and they suddenly smile with joy.)

El Landerson: SANTA!

(A man dressed up in Santa Claus attire appears towards the scene, as he extends his arms open to a confused Ashten Cross.)


(Maxwell Dachs, along with Team DCW, groove together once more, as the other EAW Elitists and Vixens stand in the background in silence and in confusion.)

Santa Dachs: Ashten Cross, you have been a very bad boy this year….VERY bad. If you wish to appear on my Nice list, please give Team DCW justice right now…

Ashten: Shouldn’t you be taking this up with James Shields?? I’m not even your General Manager for gods sakes! Maybe if you guys didn’t just such so terribly in every match that you per—


El Landerson: Oooo, kill em!

Venom: Besides, what kind of a man drinks wine, huh? This isn’t the 1700s :S…

(Venom grabs the glass of wine from the table, and he splashes it across Ashten Cross and company.)

Venom: And ya’ll need some deoderant, like what the….

(Ashten Cross immediately kicks Venom in the gut, with a horde of EAW Elitists and Vixens attack Team DCW and a massive brawl ensues. Serena Ji is shown pulling the fake beard of Santa Dachs, Piff Fumador launching jabs right across the face of Keith Keller, while El Landerson is shown sprinting away across the hall, being rushed from behind by Jay Omen…


(The camera zooms out to reveal the rest of Team DCW left in ruins, as Venom, Keith Keller, and Santa Dachs remain unconscious on the floor. Ashten Cross grabs Dachs’ Christmas hat from off the floor, as he puts it over his head.)

Ashten Cross: ….Merry Christmas to you All! And to all shut the hell up.

(Christmas ornaments go flying at Ashten Cross’ head, and Ashten Cross flees from the scene, as he extends his legs over the pile of bodies left on the floor. The remaining EAW Elitists and Vixens all laugh together while celebrating.)

( Camera cuts back to the arena and appears on screen )

( Video package plays of the build up to the EAW Championship chamber, including Jamie O’Hara’s injury, Thomas Minns making his presence known in the EAW Title scene with his attack on Xavier Williams and alienating himself from the other members of the chamber. HBB and Pizza Boy qualifying for the Chamber as well as Xavier Williams, and all of the interactions in between. )

( The camera cuts to the ring where the Chamber is already placed around the ring. The lights dim in the arena as the Ring Announcer gets into the ring with a mic in hand. )

Ring Announcer: This match Is an ELIMINATION CHAMBERS MATCH!! IT IS FOR THE EAW CHAMPIONSHIP!!! The first four Elitists to enter the Chamber will enter their respective pods, while the last two to enter the Chamber will begin the match! After every time interval, a random pod will open. The only ways to win this match are by pinfall or submission! The Elitist to secure the final pinfall or submission will either retain or become the EAW Champion! Introducing to the Chamber first…

( “The Darkness of My Mind” by Trivium blasts through the speakers as the arena fills up with a roar of cheers from the crowd. Jamie O’Hara emerges onto the stage with the EAW Championship around his waist, red and green tights, and a leather jacket on. )

Ring Announcer: Making his way to the ring… Weighing in at two hundred and fifteen pounds… From Sydney, Australia… HE IS THE ELITE ANSWERS WRESTLING CHAMPIOOOOOOOONNNN… JAMMIEEEEEEEE OOOOOOO HARAAAAAAA!!!!

( O’Hara walks down the ramp shaking hands with the fans all the way down. He stops at the Chamber door, takes a deep breath, then walks in. He gets into the ring, climbs to the top turnbuckle, throws the Championship to the top of one of the pods, then climbs to the top of it. He holds the Championship above his head. )

Eddie Mack: The Champ has a tough challenge ahead of him as he’s taking on five challengers who are hungry for the Title he possesses.

Matt Ryder: There’s no knowing how a match like this can go, broski. You just have to give it all you can and hope for the best!

( O’Hara jumps down off the pod. He hands the EAW Championship to the Ref after kissing it, then gets in his pod as “The Darkness of My Mind” fades out. )

Ring Announcer: Challenger number one…

( Lighting in the arena turns light blue as “Legend” by Drake begins to play through the PA System. The crowd erupts into a roar of boos as Thomas Minns steps out onto the stage wearing black and blue underwear tights and has a “Minns City” shirt on. He looks behind him and whistles as two sexy women come up behind him and hold his arm. )

Ring Announcer: Weighing in at two hundred and twenty pounds… From Seattle Washington… “THE MENTAL MASTERMIND” … THOOOOOOOOOOOMAAAASS MINNNSSSSS!!!

( Minns and the two women make their way down to the Chamber. A couple fans reach their hands out to touch Minns and he tells one of the women to get their hands away from him. They stand in front of the Chamber door as the two girls kiss him and take his shirt off for him. He opens the door and the girls walk away. After stepping into the Chamber he gets to the middle of the ring and poses. )

Eddie Mack: He’s been on a roll lately and he can only hope he can keep it up and survive a match of this caliber. Maybe he can even walk away with the EAW Championship. What an upset that would be!?

Matt Ryder: I think it’s a little too early in his career. He’s proven to be a worthy challenge, but I’m not sure if he can pull this one off.

( Minns steps out of the ring and into his pod as “Legend” by Drake fades out. )

Ring Announcer: Challengers two and three…

( “Paul Revere” by Beastie Boys lights up the arena. Barney, Stand and Deliver’s manager, walks out onto the stage with a microphone. )


Eddie Mack: I can only imagine these two working together until the final moment if they both make it that far. Why would they throw away a friendship so early when you can work together to make it to the end?

Matt Ryder: I see them working together going wrong, or them not even getting a chance to work together. I’m sure that’s what these challengers are thinking about currently.

( The fans get on their feet cheering as Heart Break Boy and The Pizza Boy step out onto the stage together. Both wearing the same tights, they make their way to the Chamber. They both interact with the fans on the way down the ramp, high five each other, then step into the Chamber. HBB climbs onto the top of the Pod that Minns is in and Pizza Boy climbs to the top of the Pod that O’Hara is in. They raise their hands as the fans continue to cheer then hop down and get in their Pods as “Paul Revere” fades out. )

Ring Announcer: And the fourth challenger…

( “Never Giving Up” by Of Mice And Men blasts throughout the arena as Xavier Williams steps out onto the stage. Xavier makes his way down to the ring in just tights. He ignores all fans and makes it straight for the Chamber where he walks in and taunts every competitor in their pods. )

Ring Announcer: Weighing in at two hundred and thirteen pounds… From Detroit, Michigan… He is the “Best In The World”… XAVIERRRRRRRRRRRRRRR WILLLIAMMMSSSSSSSSSS!!!!!!1

( “Never Giving Up” starts to fade out as he enters his pod. )

Eddie Mack: He sure seems to be focused on this match. Perhaps, more focused than he’s ever been for a match before!

Matt Ryder: Can you blame him, bro? He’s got a huge match about to begin and he wants his Title back! Now we wait to see who the mystery entrant is…

( Moments go by… )

Ring Announcer: And he is the fifth challenger as well as the SIXTH MAN..


( The arena goes pitch black. “Emperor’s New Clothes” by Panic! At The Disco blasts through the arena as screams are heard echoing all throughout.)



( Aren Mstislav steps out onto the stage, his entire body painted to look like Marvel’s Venom. He’s got black trunks on with gold on the back with the words, ‘Russian Prince’ written on them. )


( Aren runs down to the Chamber, walks through the door and, ready to get this match under way! )

(Ding! Ding! Ding!)



Jake Mercer: AREN KICKS OUT BEFORE ONE AND THE TWO COMPETITORS ARE RIGHT BACK UP TO THEIR FEET! Xavier takes down Aren with a leaping clothesline! Another leaping clothesline! Xavier goes for another but this time Aren ducks and nails a slingblade, disorientating Xavier for a moment! Xavier scrambles to the corner BUT AREN ALMOST FLIES RIGHT THROUGH HIM WITH A RUNNING DROPKICK! Xavier falls to his knees but tries to hold himself up with the ropes… AND AREN RUNS RIGHT BACK FOR HIM! HE PLAYS RIGHT INTO XAVIER’S TRAP AS HE’S THROWN OVER THE TOP ROPE AND ON TO THE CHAINLINK FLOOR!! AREN BEGINS WRITHING IN SHEER PAIN AS THE OTHER COMPETITORS LOOK ON! Xavier joins Aren outside and gets right in the face of Thomas Minns and Minns is… laughing? Thomas Minns is right up in Xavier’s face, mocking him from inside that pod! WAIT, AREN MSTISLAV FROM BEHIND! AREN RUNS RIGHT INTO XAVIER, SENDING HIM STRAIGHT INTO THE CHAMBER POD! –THEY’VE CRACKED THE POD!! THE POD HAS CRACKED!! THOMAS MINNS JUMPS BACK IN FEAR!! HIS POD DOOR WAS ALMOST DESTROYED FROM THAT IMPACT! HE CAN’T BELIEVE IT!!

Matt Ryder: Bro, talk about a close call! He almost got dragged in to this match earlier than expected! I wouldn’t want to be involved in a fight between these two if I were him either! Xavier clutches his ribs but Aren continues his assault, delivering vicious knees to the gut and chest region! Xavier tries to regain control with everything he’s got AND HE SLAMS AREN’S BACK IN TO THE CHAINLINK WALL! BACK BODY DROP TO AREN BACK IN TO THE RING! Xavier rushes to climb the top rope… FROG SPLASH!! XAVIER WILLIAMS CONNECTS WITH THE FROG SPLASH AND HE HOOKS THE LEG!!


Matt Ryder: AREN KICKS OUT AT TWO!! BUT XAVIER’S CALLING FOR AREN TO GET UP!! HE HAS TO HAVE SOMETHING SPECIAL IN STORE AS AREN PULLS HIMSELF UP TO HIS FEET, COMPLETELY UNAWARE OF XAVIER STALKING HIM FROM BEHIND… END OF HEART– NO!! AREN IS CARRYING XAVIER ON HIS BACK! OVER-THE-SHOULDER JAWBREAKER!! I SURE HOPE XAVIER HAS A GOOD DENTAL PLAN, BRO! XAVIER GRABS HIS JAW IN AGONY! Aren gives him no time to breath with a series of vicious kicks, forcing Xavier against the ropes! Aren irish whips him across the ring! A dropkick attempt by Aren but Xavier uses the ropes to keep himself back! NOW BOTH MEN RUN AT EACH OTHER WITH EVERYTHING THEY’VE GOT! LEFTS AND RIGHTS FLYING FROM EACH OF THEM, NEITHER ONE WANTING TO GIVE THE OTHER ANY TIME TO BREATHE! A kick to the gut from Xavier Williams, knocking Aren Mstislav groggy and he follows up with a kick to the chest, forcing Aren back to his vertical base! ROLLING ELBOW!! AREN GOES DOWN! XAVIER SPRINBOARDS OFF THE ROPES FOR THE LIONSAULT… AND HE CONNECTS!! HE BOUNCES BACK UP TO HIS FEET AND HITS A HUGE PENDULUM ELBOW TO THE CHEST!! The wind might just be taken out of Aren for good after that combination of moves, broski!

(All of a sudden, the lights begin flashing on each of the pods and the countdown begins. 5… 4… 3… 2… 1… BUZZ! The Heart Break Boy’s pod opens!)

Jake Mercer: The Heart Break Boy is the first out of his pod and he turns his attention straight to Xavier! The two of them begin circling the ring …Both men staring each other before they begin trading blows! HBB and Xavier Williams trading fists in the ring as Xavier knees HBB in the mid-section and Irish-whips HBB off the ropes and looks for the clothesline but HBB LEAPS AND TAKES XAVIER DOWN WITH A LOU THESZ PRESS!!! HBB UNLOADING ON XAVIER WILLIAMS!!! HBB THROWING HUGE LEFTS AND RIGHTS ON XAVIER WHO IS TRYING TO COVER UP!! HBB gets back up to his feet, HBB looks the most motivated that we’ve ever seen him in a very long time! HBB lifts Xavier Williams up to his feet by grabbing his head and THROWS XAVIER OVER THE TOP ROPE AND SENDS XAVIER CRASHING DOWN INTO THE STEEL FLOOR!!! Xavier is rolling on the ground clutching his back as Minns is watching on smirking, HBB walks out onto the steel Elimination floor as he grabs Xavier up and WHIPS XAVIER INTO THE WALL OF THE ELIMINATION CHAMBER!! HBB PULLS XAVIER BACK AND WHIPS HIM ONCE AGAIN INTO THE ELIMINATION CHAMBER CHAIN-WALL!!!! HBB LOOKING FOR A THIRD ONE BUT WATCH OUT!!! AREN MSTISLAV CHARGES AND FLIES OVER THE TOP ROPE CONNECTING WITH A SOMERSAULT SPLASH INTO HBB AND XAVIER WILLIAMS!!!! ALL THREE MEN CRASHING INTO THE STEEL FLOOR!!!!!! OH MY GOD!!!!! ….All three men are down here on the floor, Aren cushioned his fall on Xavier and HBB’s body as he sits up, that took a good bit out of Aren but he lifts himself to his feet as he grabs HBB and rolls him back into the ring, Aren gets into the ring and lifts HBB up to his feet – POWERBOMB ON HBB!!!!! AREN DRIVES HBB INTO THE MAT!!! AREN COVERS HBB!!!!

Ref: ONEEEEEEEEEEEEE!!!!!!!!!!!!! ….TWOOOOOOOOOOOOO!!!!!!!!!! ……..NO!!!!! HBB KICKS OUT!!!!!!!

Matt Ryder: It’s going to take more than that to beat HBB broski! Aren looks annoyed as he gets to his feet and is stalking HBB, he’s waiting for HBB who is slowly lifting himself to his knees as Aren LOOKS FOR THE VENGEFUL UPBRINGING!!!! THE SUPERKICK TO A KNEELING HBB!!! BUT HBB DUCKS HIS HEAD DOWN AND ROLLS AREN UP FROM BEHIND!!!!! BUT NO!!! AREN ROLLS THROUGH ONTO HIS FEET BEFORE A COUNT COULD BE MADE AND QUICKLY CONNECTS WITH THE VENGEFUL UPBRINGING ONTO HBB!!!!! RIGHT INTO THE KISSER!!! HBB FALLS DIRECTLY ONTO HIS BACK, HE LOOKS OUT OF IT BUT RIGHT FROM BEHIND XAVIER IS ON HIS FEET ON THE FLOOR AS HE GRABS AREN BY THE ROPES AND LOCKS IN A SLEEPER HOLD!!! AREN IS BEING PRESSED UP TO THE ROPES AS XAVIER IS TRYING TO DRAG HIM OVER THE TOPS AND ONTO THE CHAMBER FLOOR!!!! AREN IS THROWING ELBOWS INTO THE FACE OF XAVIER!!!! SEVERAL ELBOWS BY AREN INTO THE FACE OF XAVIER WILLIAMS!!!! Xavier breaks that hold as he stumbles backwards, Xavier has already taken a good deal of damage here as Aren hits off the ropes again and FLIES WITH A SUICIDE DIVE INTO XAVIER!!!!! NO!!!! XAVIER GRABS AREN IN HIS ARMS!!!! XAVIER GETS AREN ONTO HIS SHOULDERS AND TURNS AROUND — XAVIER POWERBOMBS AREN MSTISLAV INTO THE CHAMBER WALL!!!!!! AREN IS DRIVEN SPINE FIRST INTO THAT CHAIN-LINK FENCING AND DUMPED ONTO THE FLOOR!!!! BAH GAWD ALMIGHTY!!!! WHAT CARNAGE HERE!!!!! Aren is down, HBB is down, and Xavier turns his focus right towards the cracked pod of Thomas Minns as Xavier BOOTS that cracked pod, Xavier isn’t even going to wait for Minns to be released, he wants him now! Xavier is trying to kick that cracked pod apart!

( …We get a birds-eye of the chamber as the countdown begins …10! 9! 8! 7! 6! 5! 4! 3! 2! 1! ….BUZZZ!!!!!!!!!! Pizza Boy’s pod opens )

Jake Mercer: Here comes the Pizza Boy! Pizza Boy from behind grabs Xavier and swings him around, is Pizza Boy insane?! Pizza Boy sending fists into Xavier but Xavier knees Pizza Boy in the mid-section and RAMS HIM HEAD FIRST INTO THE CHAIN-WALL!!!! OH MY GOD!!!! XAVIER NOW GRINDING THE FACE OF PIZZA BOY INTO THAT CHAN-WALL!!!! WHAT WAS PIZZA BOY THINKING?! Xavier throws Pizza Boy back into the ring as he follows him with Pizza slowly lifting himself up onto his feet as Xavier grabs him and pulls him in!!! DDT! No! Pizza Boy spins out of it and connects with a TWISTING ENZIGURI!!! RIGHT INTO THE HEAD OF XAVIER!!! Xavier stumbles into the turnbuckle as Pizza Boy quickly charges looking for a turnbuckle dropkick but Xavier counters with a LARIAT!!!!! XAVIER ALMOST TAKES PIZZA BOY’S HEAD OFF!!! Xavier Williams drops to a knee, he wants his title back and he’ll go through hell to get it but look! HBB is back on his feet as he grabs Xavier and connects with a snap suplex! HBB quickly checks on Pizza Boy, helping him to his feet as I believe these two are going to team here and take advantage, as Stand & Deliver lift up Xavier Williams and connect with a double suplex on Xavier! Xavier rolls out of the ring, but both HBB and Pizza Boy follow him as they lift him up and pull Xavier in —- DOUBLE DDT ON XAVIER WILLIAMS!!!! STAND AND DELIVER JUST DROVE THE HEAD OF XAVIER WILLIAMS INTO THE CHAMBER FLOOR!!!! XAVIER IS OUT COLD ON THE GROUND!!! XAVIER IS BUSTED OUT, HE’S BUSTED OPEN FROM HIS FOREHEAD!!!! OH MY GOD!!!

Matt Ryder: Aren Mstislav is slowly lifting himself up to his feet but Stand & Deliver quickly begin working over him, sending shots into him as HBB tackles Aren DIRECTLY into that chain-link fence! Aren is clutching his back in pain as Pizza Boy quickly charges and NAILS A DROPKICK INTO AREN ONCE AGAIN SENDING HIM INTO THE CHAMBER WALL!!!! Aren drops to the floor as Pizza Boy is also down, landing hard on that chamber floor as HBB grabs Aren and DRIVES HIS HEAD INTO THE CHAIN-LINK FENCE!!!! AND HBB DOES IT AGAIN!!!! AND AGAIN!!! AND AGAIN!!! THE HEAD OF AREN MSTISLAV DRIVEN INTO THAT CHAMBER WALL TIME AFTER TIME BY THE HEART BREAK BOY WHO LIFTS AREN UP — BACK SUPLEX ONTO THE CHAMBER FLOOR!!!! IT CONNECTS!!!! HBB JUST DROPS AREN SPINE FIRST ONTO THAT CHAMBER FLOOR!!!!! OH MY GOD!!!! STAND AND DELIVER HAVE JUST TAKEN OUT XAVIER WILLIAMS AND AREN MSTISLAV, THIS IS INSANE!!! HBB rolls Aren Mstislav into the ring as HBB begins to climb up the turnbuckle, HBB is going high-risk here ….AND HBB LEAPS OFF THE TURNBUCKLE AND CONNECTS WITH THE HEART BREAK ELBOW!!!!!! THE ELBOW OF HBB CONNECTING RIGHT INTO THE HEART OF AREN MSTISLAV!!!!! BAH GAWD ALMIGHTY!!!!! HBB QUICKLY COVERS AREN, HOOKING BOTH LEGS!!! WE COULD HAVE OUR VERY FIRST ELIMINATION HERE!!!!!

ONEEEEEE!!!!!!!!!!!!!!!!!!!!!!!!! ………TWOOOOOOOOOOOOOOOOOO!!!!!!!!!!!!!!! ………..NO!!!!!!!!!!! AREN GETS HIS SHOULDER UP!!!!! UNBELIEVABLE!!!!!!


ONEEEEEEEEEEEEEEEE!!!!!!!!!!!!!!!!!!!!!!!!! …….TWOOOOOOOOOOO!!!!!!!!!!!!!!! ……….


( We once again get a bird’s-eye view of the chamber with the lights flashing around the corner …10! 9! 8! 7! 6! 5! 4! 3! 2! 1! ….BUZZ!!!!!!! Jamie O’Hara’s pod opens )


Ref: ONEEEEEEEEEEEEEEEEEEEE!!!!!!!!!!!!!!!!!!!!!!!! ……….TWOOOOOOOOOOO!!!!!!!!!!!!!!!!!!!!!! …….NO!!!!!!!!!!!!!!!!!!!!! PIZZA BOY BREAKS IT UP!!!!!!!

Matt Ryder: PIZZA BOY OBVIOUSLY PROTECTING HIS OWN INTERESTS HERE BY KEEPING HIS PARTNER IN THIS MATCH!!!! Jamie O’Hara is getting to his feet as Pizza Boy charges at him but O’Hara evades it and connects with a dropkick on Pizza Boy! Jamie is the MASTER of the dropkick and Pizza Boy stumbles into the turnbuckle and Jamie charges at him but Pizza Boy evades it by ducking underneath Jamie and PIZZA BOY CONNECTS WITH A PELE KICK!!! Jamie slumps to a sitting position as Pizza Boy walks to the opposing turnbuckle and quickly charges at Jamie WITH A RUNNING BASEBALL SLIDE DROPKICK INTO THE FACE OF JAMIE O’HARA!!!! Jamie falls to the mat and rolls out of the ring onto the chamber floor but Pizza Boy is wasting absolutely NO time here as he hits off the ropes and charges and LEAPS OVER THE ROPES WITH A RUNNING SPLASH OVER THE TOP ROPE AND INTO JAMIE O’HARA ON THE CHAMBER FLOOR!!!!! BUT JAMIE GETS HIS KNEES UP!!!! PIZZA BOY CRASHES INTO THE KNEES OF JAMIE O’HARA!!! Pizza Boy is rolling around on the floor clutching his ribs as Jamie grabs the ropes and begins to lift himself up as he grabs Pizza Boy and lifts him up to his feet and CONNECTS WITH THE DOWN UNDER!!!!!!! DOUBLE A SPINEBUSTER ONTO THE CHAMBER FLOOR!!!!!!! JAMIE O’HARA JUST DROVE THE PIZZA BOY INTO THE CHAMBER FLOOR SPINE FIRST!!!! OH MY GOD!!!!! PIZZA BOY IS LAID OUT ON THE CHAMBER FLOOR!!!!! THE RUTHLESSNESS OF THE EAW CHAMPION ON DISPLAY HERE!!!! JAMIE WAS IN AN ELIMINATION CHAMBER LAST YEAR, HE CAME UP SHORT AND KNOWS WHAT IT TAKES TO HAVE TO THIS AND THIS MEANS YOU HAVE TO DESTROY YOUR OPPONENTS AND JAMIE COVERS PIZZA BOY ON THE CHAMBER FLOOR, FALLS COUNT ANYWHERE!!!!

ONEEEEEEEEEEEEEEE!!!!!!!!!!!!!!!!!!!!!!!!! ………..TWOOOOOOOOOOOOOOOOOOOO!!!!!!!!!!!!!!!!!!!!! …………….PIZZA BOY KICKS OUT!!!!!!!!!


( The lights dim as the countdown begins to play 10! 9! 8! 7! 6! 5! 4! 3! 2! 1! ….BUZZ!!!!!! Thomas Minns enters the chamber )


ONEEEEEEEEEEEEEEEEE!!!!!!!!!!!!!!!!!!!!!!!!! ………..TWOOOOOOOOOOOOO!!!!!!!!!!!!!!!!!!!!!……….NO!!!!!!!!!! JAMIE KICKS OUT!!!!!

Jake Mercer: Thomas Minns looks annoyed here! Minns gets on top of the EAW Champion and begins ground and pound on Jamie O’Hara! Several punches into the head of Jamie! Minns lifts up Jamie, he’s looking to finish what he started as he grabs Jamie and pulls him in —SLEEPLESS IN SEATTLE!!!!! NO!!!! JAMIE SPINS OUT OF IT AND NAILS MINNS IN THE MID-SECTION AND PULLS HIM IN!!!! DDT CONNECTS ON THOMAS MINNS!!!! JAMIE O’HARA GOT THAT OUT OF DESPERATION AND BOTH MEN ARE DOWN!!!! BAH GAWD ALMIGHTY!!! Jamie quickly grabs that arm, you have to wonder if Minns re-injured that arm by driving it into the floor but we KNEW it would be a factor in this match as HBB is back on his feet as he looks to take advantage, stomping on his foot, HBB is tuning up the band!! Thomas Minns is getting up to his feet as HBB CONNECTS WITH THE GOLD PRINT!!!!!! OH MY GOD!!!! HBB CONNECTS WITH THE GOLD PRINT ON THOMAS MINNS!!!! MINNS GOES DOWN!!!!!! HBB JUST TOOK HIS HEAD OFF!!!!!! MINNS IS LAID OUT IN THE RING!!!!!! HBB NAILED IT!! HBB GOT IT!!!!! HBB QUICKLY GOES FOR THE COVER!!!! WE’VE GOT OUR FIRST ELIMINATION OF THE MATCH!!!!!!

Ref: ONEEEEEEEEEEEE!!!!!!!!!!!!!! ………..TWOOOOOOOOOOOO!!!!!!!!!!!!!!! ………….


Xavier Williams: HE’S MINE!!!!!!!


Ring Announcer: The Heart Break Boy has been eliminated by Xavier Williams!



Ref: ONEEEEEEEEEEEEEEEEE!!!!!!!!!!!!!!!!! …….TWOOOOOOOOOOOOOO!!!!!!!! ………….




Jake Mercer: Aren is climbing down the chamber, scaling down that chamber wall and AREN QUICKLY COVERS PIZZA BOY!!!!! ONE OF THE OUTSIDE REFEREES MAKES THE COVER, IN THE WRECKAGE OF THAT BROKEN TABLE!!!!!!!!!!!!!


Ring Announcer: The Pizza Boy has been Eliminated by Aren Mstislav!




ONEEEEEEEEEEEEEEEEEE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! ………..TWOOOOOOOOOOOOOOOOOO!!!!!!!!!!!!!!!!!!!!!!! …………..THREEEEEEEEEEEEEEE!!!!!!!!!!!!

Ring Announcer: Xavier Williams has been eliminated by Aren Mstislav!



Ring Announcer: Thomas Minns has been eliminated by Aren Mstislav!






( Ding! Ding! Ding )

( The Darkness Of My Mind – Trivium hits )


( Jamie crawls to the ropes and drags himself up to his feet with everything he’s got as the official hands him his EAW Championship and raises his arm )


Matt Ryder: Jamie O’Hara went in this match as EAW Champion, outlasted five other men, is leaving this match still EAW Champion and I STILL wouldn’t want to be him right now! This young man went through an absurd — I mean ABSURD level of punishment and quite honestly he might have sacrificed more than he’s gained!

Jake Mercer: For once I agree with you, Matthew! I’ve never seen Jamie O’Hara in a condition like this! Safe to say this young man has been thrown into the deep end this whole year, but at the very least he gets to close it STILL EAW Champion!

( A cleaning crew enters the ring to repair the damage all over the chamber and Jamie O’Hara is helped out of the Chamber by several officials… the screen fades to black )



(Video package plays for the Voltage Elimination Chamber)

(Camera pans back to the ring as spotlights appear on the descending Elimination Chamber structure)

Announcer: The following contest… IS AN ELIMINATION CHAMBER MATCH AND IT IS FOR THE ANSWERS WORLD CHAMPIONSHIP!!! The match will begin with two competitors and four others in their pods… every five minutes, another competitor is randomly selected to enter… the only way to win is if one competitor is left after five others have been eliminated by pin or submission!

(“Monster” by contRoVersy plays all throughout the arena as Ares Vendetta makes his way to the stage in a black and gold ring attire)

Announcer: First, making his way to the ring… from Tokyo, Japan!… weighing in at 217 pounds!… ARES VVVVVEEEEENNNNNDDDDDEEEEETTTTTTTTTTAAAAA!!!…

Eddie Mack: Ares Vendetta is the first to come out, leading the pack the way he thinks he should. Ares Vendetta is no longer driven by his father’s legacy, he wants to create his own place in history, he believes he is destined for it. The countdown has reached its end and now tonight is the moment of truth, will the end of its count really spell doom for his opponents?

(“The Man Who Sold the World” by Midge Ure plays all throughout the arena as Liam Catterson makes his way to the stage in a black, red and white ring attire)

Announcer: Next, making his way to the ring!… from Shildon, United Kingdom!… weighing in at 225 pounds!… LIAM CCCCCAAAAATTTTTTTTTTEEEEERRRRRSSSSSOOOOONNNNN!!!…

Kawajai: Liam Catterson is back where he believes he belongs : In the Answers World Championship scene. He’s undergone under a major change in persona since Shock Value. It felt as if Liam Catterson was finally looking to the future and hoping to be a mentor to the locker room, but of course his ego and sense of entitlement got the best of him. It’s all about him once again and he is here to reclaim what was once his!

(“The Embrace” by AFI plays all throughout the arena as Ryan Savage makes his way to the stage in a black and white ring attire with a “Respect None, Fear None” t-shirt)

Announcer: Next, making his way to the ring!… from Cleveland, Ohio!… weighing in at 250 pounds!… RYAN SSSSSAAAAAVVVVVAAAAAGGGGGEEEEE!!!…

Eddie Mack: This has all makings to be a very big night in the career of Ryan Savage. Ever since coming to EAW, all Ryan Savage has done is achieve. He’s won the Young Lions Cup, the New Breed Championship, The Pure Championship, the Tag Titles, he’s done everything there is to do except become a World Champion. This Chamber is his opportunity to break through that glass ceiling placed above him by his doubters and do the one thing that would provide his career with the final accolade to show everyone how legit of a competitor he really is!

(“This Means War” by Avenged Sevenfold plays all throughout the arena as Devan Dubian makes his way to the stage in a black and red ring attire with the Answers World Championship over his shoulder)

Announcer: Next, making his way to the ring!… from Leicester, England, United Kingdom!… weighing in at 230 pounds!… HE’S THE REIGNING AND DEFENDING ANSWERS WORLD CHAMPION… DEVAN DDDDDUUUUUBBBBBIIIIIAAAAANNNNN!!!…

Kawajai: Right now Devan Dubian is coming into that Chamber on the biggest role of his career, he’s been riding high ever since Pain For Pride. It’s as if whenever we think his Championship reign is done for he pulls through and raises the bar even higher in his defenses. The odds may look challenging but at this stage Dub doesn’t seem to be worried at all. He looks confident and with his track record I could see tonight being another night of us seeing once again just how damn good of Elitist he is!

(“The Wreckoning” by Nonpoint plays all throughout the arena as Scott Oasis makes his way to the stage in a black and orange ring attire with a gray denim jacket)

Announcer: Entering at Number 2!… from Baltimore, Maryland!… weighing in at 260 pounds!… SCOTT OOOOOAAAAASSSSSIIIIISSSSS!!!…

Eddie Mack: Scott Oasis has said so himself that tonight is he entering that Chamber as a desperate man, a man obsessed with obtaining Championship gold. For the past few months all Oasis has wanted to do is prove himself as a big time player and that he is above just being something like an Interwire Champion. His judgement has become clouded in the process, he’s become even more unhinged. Scott Oasis is not in the right place mentally and in an environment like the Elimination Chamber, that could actually be a benefit.

(“Right For Me” by Eminem plays all throughout the arena as Mr. DEDEDE makes his way to the stage in a black, red and white ring attire with a dark gray coat)

Announcer: Entering at Number 1!… from Denver, Colorado!… weighing in at 230 pounds!… MR. DDDDDEEEEE! DDDDDEEEEE! DDDDDEEEEE!!!…

Kawajai: If there’s anyone in this match who knows what he’s doing, it has to be Mr. DEDEDE. DEDEDE has picked up years of Chamber experience, in fact just last year he walked into the Dynasty Chamber, one of the most stacked Chambers in years and became apart of the select few to actually retain his title. Memory shows that he will do whatever it takes when it comes to winning championships, and with a newfound fire inside him, he is out to show everyone that “The Gawd” can still dominate singles competition.


Eddie Mack: The bell rings, signaling the start of the match as this Answers World Championship match has officially begun. Mr. DEDEDE and Scott Oasis are starting this off, the first time we’ve ever gotten to see these two compete one on one. Mr. DEDEDE is eyeing his surroundings and scouting his opponent, circling around Scott Oasis while he does it. DEDEDE must be trying to think out a game plan before he engages his opponent. Scott Oasis seems to be growing impatient as he moves forward to Mr. DEDEDE, but DEDEDE just backs away and scampers off across the ring. Scott Oasis is having none of that though, he shoots straight at DEDEDE! Mr. DEDEDE has to think on his feet as he puts his hands up to block Scott Oasis’s advances, pressing him down to the canvas in a front facelock! Scott Oasis can not be contained though, he’s pushing on and forcing his way out of the hold! Scott Oasis gets up on his feet and grabs the side of DEDEDE’s tights! OVERHEAD BELLY TO BELLY SUPLEX!! Mr. DEDEDE crawls over to the corner after that and pulls himself up with the ropes but Scott Oasis does not allow him to rest! Running knee lift! Scott backs off following the attack and then rushes back in for multiple shoulder thrusts to the gut! Mr. DEDEDE almost sinks down in his corner until he falls over into the arms of Oasis! Hip toss, sending DEDEDE flying halfway across the ring! Scott Oasis settles into that corner and watches Mr. DEDEDE get back up, ready to mow him down with a big boot, but Mr. DEDEDE ducks right under it! He peppers Oasis with a couple of rights to rock him into the ropes!

Kawajai: Mr. DEDEDE is looking for an Irish whip but Scott Oasis uses the momentum for a clothesline! Mr. DEDEDE avoids it in time and turns him around for a jumping reverse STO! Scott Oasis lays flat on the mat as Mr. DEDEDE hits the ropes himself! Scott Oasis is able to return to his senses and get out of dodge before fully returning to his vertical base. When Mr. DEDEDE comes back the second time around, Scott Oasis shows some amazing athleticism for his size by leapfrogging over his opponent! OH! Mr. DEDEDE telegraphed it though and dropped to a knee, letting Oasis take a low blow on the way down! Mr. DEDEDE has been in his fair share of Elimination Chamber matches and knows to take advantage of the No DQ stipulation! Scott Oasis is for sure favoring that! With Scott Oasis’ knees having buckled from the shot below the belt, Mr. DEDEDE is able to nail him with a kick to the side of the head! Scott Oasis’ whole equilibrium is off from that, he wobbles around looking to throw a punch at Mr. DEDEDE but Mr. DEDEDE catches his hand and sets him up– Half Nelson bulldog!

Eddie Mack: Mr. DEDEDE leans over to pick up Scott Oasis but Oasis stuns him with a jawbreaker to buy himself some time! Mr. DEDEDE readjusts his jaw and comes back around into a elbow to the abdomen! Scott Oasis pulls him in and and holds DEDEDE by his side, backbreaker! Mr. DEDEDE almost falls off until Scott Oasis keeps him up on his feet and backs off….oh man……MR. DEDEDE IS TOSSED OUT OF THE RING AT FULL SPEED, LANDING HARD ON THE STEEL! Scott Oasis gets between the ropes to join him out there, picking him up as he hopes to continue the punishment by flinging DEDEDE into chain linked wall! He puts DEDEDE over his shoulder and goes to throw him like a dart! NO! Mr. DEDEDE desperately gouges at his eyes and falls behind him… TRIPLE D DRIVER! DEDEDE is letting Oasis get situated with the steel himself! Things are off to a wild start as the clock begins to tick away to our first entrant!

(The lights begin to flash on the pods at random, the cadence becoming faster and faster as it goes on. )


Eddie Mack: The light stops at the pod of Ryan Savage, much to his delight! Ryan is absolutely ecstatic, wanting the officials on the outside to hurry up with the unlocking! He bursts through his pod and immediately goes right after his former partner Mr. DEDEDE! Ryan gets in the ring, walks over to the side of the chamber he’s at and brings him back into the ring by the hair! Mr. DEDEDE can’t even get up as he is bombarded by stomps while he’s down! We can see DEDEDE’s mouth beginning to bloody as Ryan’s boot catches him in the mouth! Once Ryan thinks he has done enough, he places DEDEDE back up to his feet. DDD raises his fists but Ryan moves them out of the way and leaves himself defenseless to some chops to the chest! Ryan Savage with a flurry here that he finished off with a Cross Chop right to the throat! Ryan Savage leaves DEDEDE be for the moment — BUT HE RETURNS FOR A CORNER SPLASH! Mr. DEDEDE slides down and seats himself in the corner in a daze! Not a good idea, it gives Ryan the perfect segway for his next attack! ROLLING SENTON INTO HIS SEATED OPPONENT! Mr. DEDEDE is almost out like a light! Ryan Savage drags him off by the leg to the center of the ring and then goes for the first pinfall of the match!

Referee: ONEEEE!!!….TWOOOO!!!!…..KICKOUT!!!!!

Kawajai: Mr. DEDEDE strongly pushes out of that cover! DEDEDE turns over onto his side but Ryan Savage puts him right onto his back once again! Ryan Savage with a leg drop! Mr. DEDEDE can barely breathe, he goes to catch his breath but Ryan jerks him upward and lifts him high up in the air! Ryan Savage is going for a powerbomb! DEDEDE slides off and wants to turn the tables but Ryan side steps him! Mr. DEDEDE is sent running to the ropes and Scott Oasis is there, about to re-enter — WHEN MR. DEDEDE USES HIS RUNNING START TO HIS ADVANTAGE, PUTTING A STOP TO OASIS’ RETURN TO THIS MATCH WITH A SPEAR! Scott Oasis just fell back and bumped the back of his head on the steel floor! Mr. DEDEDE admires his work with a smile on his face, a big mistake with Ryan Savage right behind him! German suplex! Mr. DEDEDE is in a very bad way here and things are about to get worse! A powerful lariat turns him inside out! Ryan Savage ran DEDEDE down like a freight train! Ryan hit him so hard even his arm is hurting from that! Ryan looks down at Mr. DEDEDE and sees that he is hardly even starting to stir….he walks away from his rival and sets his sight on Scott Oasis who is still on the outside! Ryan Savage gets a hold of him, he is about to reintroduce Scott Oasis to this match!

Eddie Mack: Ryan Savage does what Oasis couldn’t do as he launches him into that chain link wall at full speed! Between that, the Spear and the Triple D Driver I don’t know how Scott Oasis is even awake right now! Scott collapses face first on the floor and that leaves his back turned to Ryan! Ryan is literally walking up the spine of Oasis, pressing down as hard as he can and with as much weight as possible! Ryan Savage doesn’t stop until he reaches the neck of Oasis, he then steps off and drops down to Oasis’ level, getting in his face and slapping him around! Ryan Savage showing nothing but disrespect to both of his opponents. Ryan has bad thoughts right now, he’s yelling at Oasis like a madman, egging him on, trying to question him as an Elitist! Scott Oasis takes a knee, he wants to fight…BUT RYAN SAVAGE RUNS UP TO HIM! DOUBLE FOOT STOMP TO THE BACK OF THE HEAD, SENDING SCOTT OASIS’ SKULL INTO THE STEEL ONCE MORE! RYAN SAVAGE IS DESTROYING HIS COMPETITION RIGHT OFF THE BAT!

Kawajai: We can start to see blood pouring down the face of Scott Oasis, at first it was a little trickle but now it’s growing and growing into a full on crimson mask! Ryan Savage sees Mr. DEDEDE on the other side of the ropes and slingshots him over them, now all three opponents are on the outside at that steel floor! Ryan Savage is going for a vertical suplex on Mr. DEDEDE but DEDEDE reverses it! He ends up back on his feet and goes for the DEDEDE DDT! They’re all down now! Mr. DEDEDE starts to stand back up and is looking at the clock, it’s only a matter of time before the next entrant! Mr. DEDEDE wants to thin the herd before the time comes, he goes back to Ryan Savage but Ryan Savage has enough in him to fire back with a Discus Forearm Smash! Ryan Savage has him set up, placing Mr. DEDEDE in package powerbomb position, looking to go for Edging Humanity Out! DEDEDE is struggling though, trying to fight out of it as we are ten seconds away from our next entrant!

(The lights starts to flicker from pod to pod a second time, this time even faster than before.)


Eddie Mack: The light has stopped on the pod of Liam Catterson, Liam gets to join the fray! He comes out of his pod and ends up right next to the carnage going on at the floor! Ryan Savage has finally gotten DEDEDE up! EDGING…..HUMANITY…..OUT!!!!!…..NO!!!! Mr. DEDEDE stops it again and pushes him away, sending him right into Liam Catterson! Liam looks around and then sees that Mr. DEDEDE is coming! Liam rolls out of the way….OH MY GOD!!!! MR. DEDEDE WITH THE SPEAR ON RYAN SAVAGE, DRIVING HIM RIGHT THROUGH THE POD! THE GLASS HAS BROKEN AS SHARDS ARE STICKING IN THE BODY OF RYAN, STABBING HIM IN THE BACK!!! RYAN’S BODY IS SHAKING FROM THE SENSATION OF PAIN HE IS FEELING RIGHT NOW!!! LOOK AT THE MARKS ON HIM, DEAR LORD!!! WE HAVEN’T EVEN HAD ALL THE PARTICIPANTS COME OUT, YET ALREADY THESE GUYS ARE THROWING CAUTION TO THE WIND!

Kawajai: There’s no lengths these people won’t go to, Eddie! Mr. DEDEDE is starting to pull himself out of the mess of that pod, his arm is severely cut up from that spear but he isn’t paying much mind to it! He gets out of the pod and is bringing Ryan Savage’s unconscious body out of it also! But there’s Liam Catterson! Liam Catterson with the bicycle kick to Mr. DEDEDE as he grabs a hold of him and picks him up… then tosses him out of the ring and onto that steel flooring! Liam tells the referee to get down and count as he hooks the leg of Ryan Savage!


Ring Announcer: Ryan Savage has been eliminated!

Eddie Mack: Liam Catterson stole the pin! The heavy hitter Ryan Savage has been taken out of the match just like that, and at the hands of Mr. DEDEDE no less! The EMTs go to take him out of the Chamber as the person who caused his elimination, DEDEDE, doesn’t seem to be too responsive either. He tried not to show it as he came out of the pod, but that destroyed him just as much as it did Ryan! Sacrificing his being like that was not wise in the long run and there will be no rest for Mr. DEDEDE because as we just saw, Liam is done watching all of this go down, he wants to get involved! He has Mr. DEDEDE and lets that Chamber wall get a bit more fun as he rams DEDEDE into it before delivering the spinebuster! Scott Oasis has still yet to fully recover from the double foot stomp but is on his feet and showing signs of life! Liam Catterson walks up to him and clotheslines him back into the ring before climbing up to the top rope! We don’t normally see him go there but for a night like tonight I guess he’ll make an exception! ELBOW DROP BY LIAM CATTERSON FROM THE TOP ROPE, INTO THE HEART OF OASIS! Liam hooks the leg following that!


KawajaI: Scott Oasis kicks out of it! Liam Catterson doesn’t seem to be sweating it too much though! He knows that he’s in control after all of the energy exerted by his two opponents so far! He’s just messing around with these guys at this point! Powerslam on Oasis! He backs up and jumps for a knee drop across the forehead! Liam goes for another, rather lazy cover there but not even Oasis in the shape he’s in will go down with that! Liam is forcing Scott Oasis to a vertical base by guiding him by a clump of his hair and slings him over his shoulder! He drops Scott Oasis face first right onto the turnbuckle! Oasis has been beaten to the point that he just walks right into the boot to the sternum by Liam and is set up! THE CATTERSON IMPACT!!!!!

Eddie Mack: Scott Oasis picks at the legs and knocks him down, interrupting Liam’s pedigree! Scott Oasis catapults Liam right into the very turnbuckle he was just sent into, sending Liam reeling right into his clutches! Scott Oasis finally is starting to pick up some offense once again! He hits Liam with the stroke! Mr. DEDEDE has come in hoping to weasel back into the lead but Scott Oasis turns around just in time– SUPERMAN PUNCH TO THE MOUTH OF DEDEDE! Mr. DEDEDE doesn’t even know what hit him! Scott Oasis continues his series! A Samoan Drop to The Gawd! Scott Oasis lets out a roar, he’s feeling it as his confidence is building back up! In fact, he’s feeling confident enough to grab DEDEDE and carry him over to the corner, placing him on the top turnbuckle! Scott joins him up there shortly and it appears he’s setting him up for a superplex! Hang on though! Liam with a jab to the back from behind! Oasis weakens and Liam takes advantage! POWERBOMB TO OASIS! Mr. DEDEDE is still on the turnbuckle and it looks like Liam wants to get the job done himself!

Kawajai: Mr. DEDEDE knows what Liam wants too, that’s why he’s standing on the top rope! He’s climbing up Ares Vendetta’s pod to get some distance! Liam is pulling at his ankles but DEDEDE kicks him away and is now on top of the pod, safe and sound! Wait though! Ares isn’t taking too kindly to DEDEDE’s cowardice! He reaches out for Mr. DEDEDE’s leg and crotches him while he’s on top of the pod! The wind has been taken out of DEDEDE’s sails as the clock is running down for our next entrant!

(The crowd have picked up on the count and start to chant along as it goes down and the lights go back and forth between Ares and Dub.)


Kawajai: There’s only two options, will it be Ares Vendetta or will it be our Answers World Champion?


Eddie Mack: AAAAAAND….Devan Dubian is our lucky winner! Our Answers World Champion is now the fifth man to partake in this chamber! Devan Dubian comes out of his pod and gets right into the thick of things! He rushes in and knocks Liam Catterson off of his feet with a clothesline! Scott Oasis gets up to attack but is ducked and now he can get one too : Another clothesline! Liam gets back to his feet once again ready to charge and Devan Dubian counters him with a scoop slam! He’s on fire! Scott Oasis returns to his feet following his recovery and now Devan Dubian is getting slightly overwhelmed! A clubbing blow from behind! Devan Dubian has quick reflexes though and responds with an elbow to the face, stopping Oasis from getting a good grip of him! He’s distracted from Liam Catterson, who tackles him to the mat and now enemies become friends here as they start to double team our Champion! They know he’s fresh and want to break him down right away, punching and stomping from all sides! They are circling around Dub, chiming in with their offense as they pass him by! Devan Dubian tries to sit up but is hit right in the chest and beaten down some more! Scott Oasis tells Liam to back off for a second! He cocks his fist….A SUPERMAN PUNCH FOR DEVAN DUBIAN! Dub staggers back following that and falls right into a Russian Legsweep from Liam! Liam gets the hell out of dodge as Scott Oasis delivers a standing headbutt! These two are working surprisingly efficiently! Scott Oasis covers and Liam is looking to add his weight on top of it by pushing on his back! They may have taken out Dub as soon as he started!

Referee: ONEEEE!!!…TWOOOO!!!…..THR — KICKOUT!!!!

Kawajai: Devan Dubian saves his Answers World Championship reign! As soon as the referee deemed that he got the shoulder up, Liam and Oasis have gotten back to work on Dub! Liam holds his arms back and lets Oasis get in a sharp right to the ribs! A few more for good measure! Scott Oasis starts putting together orders and instructs Liam to make sure Devan Dubian is up on his feet! Scott Oasis takes control of holding back Dub as Liam gets on the middle rope, going for a flying axe handle but some miscommunication goes on! Dub struggles away from Oasis and leaves him to take the flying axehandle! Liam knows he messed up but he has to worry about it later because Devan Dubian is still up on his feet! THE OLYMPIC SLAM ON LIAM CATTERSON! Devan Dubian is back in this and is psyching himself up in the corner, stalking his prey! We all know what happens next….THE LAST RESORT PUNT KICK!!!

Eddie Mack: Liam moves his head out of the way! Devan Dubian is turned around and kicked in the gut, Liam is going for The Catterson Impact but is again met with push back! Dub is turning himself into dead weight to stop Liam from doing it! Liam is getting annoyed as he tries to pull him up! When he does though, Devan Dubian spins out of his double underhook– THE BLEEDING EDGE!!!!! Devan Dubian made sure to spike him as hard as he could there! Liam’s troubles aren’t done there, Scott Oasis is just as pissed off because of that axehandle ! He pulls Liam up in torture rack position! SEEK AND DESTROY! THE BURNING HAMMER TO PILE ON AS REVENGE! SCOTT OASIS COVERS!


Ring Announcer: Liam Catterson has been eliminated!

Kawajai: Scott Oasis rolls off and breathes a sigh of relief, he has just knocked off another big threat in this match, first we’ve seen Ryan go early on and now Liam! You know speaking of threats, that reminds me, where is Mr. DEDEDE?

Eddie Mack: Mr. DEDEDE is still on the pod, he’s been watching, literally playing the role of Eye in the Sky this whole time! Mr. DEDEDE is standing up on the pod! Mr. DEDEDE clutches the Chamber wall and looks down at his opponents, we all know what he is thinking! No, no, no! This is not a good idea! Mr. DEDEDE looks up in thought and when he looks back down…those crazy eyes of his are there! He’s come to the realization of what he needs to do– CORKSCREW NORTH STAR!!!!!! THE CORKSCREW SHOOTING STAR PRESS OFF THE POD RIGHT ONTO SCOTT OASIS!!!! HOLY SMOKES!!!!!!!!!, HE HAD TO HAVE KILLED HIM THERE! BAH GAWD WHAT A MOVE! MR. DEDEDE IS AGAIN BARELY ABLE TO BREATHE, MR. DEDEDE IS WILLING TO TAKE YEARS OFF OF HIS CAREER TO BECOME ANSWERS WORLD CHAMPION! HE CRAWLS OVER AND HOOKS THE LEG OF OASIS!


Ring Announcer: Scott Oasis has been eliminated!

Kawajai: Mr. DEDEDE is slowly trying to get back up to his feet, he’s been through so much in this match; he’s exhausted, he’s banged up, he’s coughing up and he can barely get up to his feet! But he’s slowly getting up… Dubian gets him in a headlock! Dubian has him in the headlock for the… for the inverted headlock backbreaker! That hurts just a little more than it normally would as DEDEDE has been through everything, there isn’t anything he hasn’t been through in this match; he’s breathing but he isn’t getting back up to his feet as Dubian looks down at him… knee drop to the face of DEDEDE! Dubian is just picking him apart right now! Dubian knows just how exhausted DEDEDE is, he knows just how banged up he is as he grabs a hold of and picks him back up… then he makes sure that DEDEDE’s feet are on the ropes as he sets him up… but what’s this? Dubian is setting this up on the other end of the ring, he’s setting him up on the outside as he… rope-hung DDT! Dubian with the rope-hung DDT as DEDEDE goes head first into the steel flooring! The head of DEDEDE could’ve just dented that steel, oh it is, the steel is dent and that could have busted him open! But I don’t think there’s any– there is, there’s blood dripping from his head!

Eddie Mack: That busted his head open but DEDEDE is somehow, someway, still trying to get back up to his feet! Dubian grabs a handful of his hair and picks him up… he throws DEDEDE into the steel structure! DEDEDE drops down, his hands up on the structure, he’s trying to breathe, he has blood dripping down from his head to his face as Dubian grabs a hold of him and picks him back up… Dubian looks at the structure and then at DEDEDE… what could he be thinking?! Dubian may be going for the… OLYMPIC SLAM!!!! OLYMPIC SLAM INTO THE STEEL STRUCTURE, DEDEDE GOES HEAD/NECK FIRST INTO IT, HIS WHOLE BODY IS THROWN AGAINST IT WITH THAT! THERE’S NO GETTING BACK UP, THERE’S NOTHING ELSE FOR HIM TO DO HERE! But look! The timer! There’s just one competitor left in those pods and that’s Ares Vendetta!


Kawajai: The pod opens as Ares Vendetta gets out of it and Devan Dubian is right there as he’s up to a kneeling position… superkick to the back of the head! Ares with the superkick to the back of the head of Dubian! Ares was there, sitting in that pod, just waiting to get his hands a little dirty in this match! Ares hasn’t been in this match for long and he’s just laying into Devan Dubian! Lefts and rights to the face as he gets up off of him and picks him up… he throws Dubian back into the ring as he turns around and looks at Mr. DEDEDE who hasn’t gotten back up… he climbs up the steel structure as he’s up there looking down at DEDEDE who still hasn’t gotten back up and– FLYING ELBOW DROP TO THE CHEST OF DEDEDE FROM OFF OF THE STEEL STRUCTURE!!! ARES WITH THAT ELBOW INTO THE CHEST OF DEDEDE AS DEDEDE IS JUST COUGHING UP AND ARES, ARES IS QUICKLY GETTING BACK UP TO HIS FEET AS HE HAS NO EMOTION ON HIS FACE, HE DOESN’T FEEL ANYTHING, HE DOESN’T FEEL BAD FOR WHAT HE HAS DONE! Not that he should but it’s unlike anything I’ve ever seen!

Eddie Mack: Ares Vendetta is going into the ring as Devan Dubian is back up and grabs a hold of him… he’s going to suplex him into the ring but the feet are on that steel flooring… Dubian is trying to pick him up but Ares with a hard right to the face of Dubian as he staggers backwards and Ares gets up on the ropes as he goes off of them– discus elbow smash! Dubian with the discus elbow smash and just like that, Ares drops down and onto the mat! Dubian is back to a kneeling position as he looks at Ares who is using the ropes to help himself back up to his feet… Dubian gets up and kicks Ares in the chest as he picks him up and over his shoulders… TRIAL BY COMBAT!!!!! –ARES LANDS ON HIS FEET BEHIND HIM AS DUBIAN TURNS AROUND AND INTO… INTO THE SAIKA KICK!!! ARES WITH THE SAIKA KICK AS DUBIAN FALLS BACKWARDS AND ONTO THE MAT!!! DEDEDE is on the outside, he’s out of it as Ares hooks the leg!

Referee: ONEEEEEE!!!!……TWOOOOOO!!!!……

Kawajai: Kickout?! Kickout! Ares Vendetta sits up as he runs his hand through his hair and looks down at Devan Dubian before getting back up to his feet… Devan Dubian has been in this match longer than Ares Vendetta has and so he’s not getting back up to his feet as quick as him but he slowly gets back up… superkick to the face! Ares with the superkick to the face of Dubian! DEDEDE is still on the outside as Ares gets up on the top turnbuckle and… and he gets up on top of one of those pods as he looks down at Dubian, oh no… METEORA!!!! METEORA OFF OF THE TOP OF THE POD… BUT DUBIAN ISN’T THERE! DUBIAN ISN’T IN THE MIDDLE OF THE RING, HE’S UNDER THOSE ROPES AS ARES’ FEET HIT THE MAT AND HE FALLS DOWN, HOLDING ONTO THAT FOOT OF HIS!!! THE FLYING DOUBLE FOOTSTOMP JUST BARELY MISSED, IT JUST BARELY MISSED THE FACE OF DUBIAN!!! That could’ve been bad, that could’ve been bad for Devan Dubian had he not got out of there or else he would’ve more than likely lost the Answers World Championship and that’s what this is about; the Answers World Championship!

Eddie Mack: There’s more at stake in this match than just the Answers World Championship though, their careers are also at stake given just how much they’ve been through so far, the Chamber was built to take years off of many careers and it has! Anyone who has ever stepped foot in the Chamber would tell you that and for Mr. DEDEDE and Devan Dubian, they know what it’s like, they’ve been in the Chamber before but Ares Vendetta, it’s as if he’s been in the Chamber before! This is the kind of match that he just thrives in and it’s been like that since he entered this match! Ares is slowly getting back up to his feet but he’s limping on that foot after missing the Meteora… oh! DEDEDE is there in the corner and Ares doesn’t know it! DEDEDE runs his hand through his hair as he’s just waiting for Ares to turn around… Ares unknowingly turns around and… SPEAR!!!!! –ARES SIDESTEPS IT AS DEDEDE GOES THROUGH THE ROPES AND ONTO THE OUTSIDE OF THE RING!!! Ares sidestepped it, even though he wouldn’t have known DEDEDE was there waiting for him, he was quick to think and so DEDEDE went through those ropes as he’s laying on the steel flooring! Meanwhile, Dubian is back up to his feet and Ares doesn’t know it… Dubian is behind him as he grabs a hold of him… OLYMPIC SLAM!!! –ARES LANDS ON HIS FEET BEHIND HIM AS HE GETS DUBIAN IN A… IN A GOGOPLATA!!! HE HAS HIM IN THE GOGOPLATA AS THERE’S NOWHERE FOR DUBIAN TO GO, ARES HAS HIM WHERE HE WANTS HIM FOR THE… HEAVENS FALL!!!! ARES WITH THE MODIFIED CODEBREAKER ON DUBIAN FROM THE GOGOPLATA POSITION!!! Ares breathlessly hooks the leg as the referee is there to count it, we may have a new Answers World Champion after this!

Referee: ONEEEEEE!!!!……TWOOOOOO!!!!…… THR–

Kawajai: Another kickout?! Another kickout! Ares Vendetta is somewhat frustrated as he gets back up to his feet… big boot to the back of the head! DEDEDE with a big boot to the back of the head of Ares as he’s back in this match! DEDEDE lays into him with lefts and rights to the face as he isn’t letting up! DEDEDE gets up off of him and grabs a handful of his hair as he picks him up… he sets him up… electric chairdrop into the facebuster! All three of them are down and out in the ring, neither of them are moving, they’re all breathing but none of them are moving! DEDEDE gets back up to his feet as he grabs a hold of Ares and picks him up… he has a hold of his tights… DEDEDE DDT!!! –ARES’ FEET ARE ON THE MAT, HE ISN’T GOING TO LET DEDEDE PICK HIM UP FOR THE DEDEDE DDT, HE’S GOING FOR SOMETHING HERE… CODEBREAKER!!! ARES COUNTERS THE DEDEDE DDT WITH A CODEBREAKER!!!

Eddie Mack: Some counter that was! Ares Vendetta could hook the leg here as Mr. DEDEDE has been in this match longer than anyone else, he entered at number one and he has managed to make it this far even though he’s been through so much! This is just unreal, so surreal that Mr. DEDEDE is even breathing after all of this! Ares is slowly getting back up to his feet as DEDEDE and Dubian are down… Ares is getting up on the top turnbuckle as he sits up there… Ares is looking down at DEDEDE; those cold, hazel eyes have no emotion, they’re as black as his heart! Ares is sitting up there… he slowly stands up on the top turnbuckle as he’s going to take DEDEDE out right here and right now… FIVE STAR PHOENIX SPLASH!!!!!!!!!!!!! THE PHOENIX SPLASH TRANSITIONED INTO THE MODIFIED FROG SPLASH– BLEEDING EDGE!!!!!!!!!!! BLEEDING EDGE OUT OF NOWHERE!!! DUBIAN WITH THE BLEEDING EDGE ON ARES AS ARES TRANSITIONED THAT PHOENIX SPLASH INTO THE MODIFIED FROG SPLASH, DUBIAN WITH THE BLEEDING EDGE JUST AS ARES TRANSITIONED INTO IT ON IMPACT!!! Dubian rolls Ares over on his back and hooks the leg! Count it, ref!


Ring Announcer: Ares Vendetta has been eliminated!



Kawajai: The chamber door is shut as Mr. DEDEDE is crawling to one of the corners of the ring… he’s crawling and crawling as he uses the ropes to himself up to a kneeling position… Mr. DEDEDE has little to nothing left in him after what he’s been through in this match but he’s not down like Devan Dubian! Mr. DEDEDE rests in the corner, using the ropes to himself up to his feet as he tries to catch his breath… Devan Dubian isn’t moving as Mr. DEDEDE looks at Ares Vendetta who looks at him… Mr. DEDEDE might have just realized what had happened to Devan Dubian! There’s some hesitation from DEDEDE… no way… NO WAY! DUBIAN IS GETTING BACK UP TO HIS FEET! EVEN AFTER THE METEORA, HE’S GETTING BACK UP TO HIS FEET AND ARES IS JUST SHAKING HIS HEAD! DUBIAN IS SLOWLY GETTING BACK UP TO HIS FEET, I DON’T KNOW HE’S EVEN ABLE TO BUT HE’S USING EVERYTHING HE HAS LEFT TO GET BACK UP… DEDEDE TAKES A DEEP BREATH AND PULLS HIS BLOODY HAIR BACK… SPEAR!!!!!!!!!!!!!! SPEAR!!!!!!!!!! SPEAR!!!!!!!!!!!!!!!!!! DEDEDE WITH THE SPEAR AS HE HAS HIS ARM ON THE CHEST OF DUBIAN!!! THE REF IS GOING TO COUNT IT!!!



(“Right For Me” by Eminem plays all throughout the arena as the Elimination Chamber is raised)


(Mr. DEDEDE is barely able to get back up to his feet, he’s bloodied and limping, breathing heavily as he’s handed the Answers World Championship)

Eddie Mack: What could be said about this match other than that these six competitors have been through so much in this match, they’ve been put through pods, they’ve jumped off pods, off of the steel structure, thrown into the steel structure… blood has been spilled as there’s drops of blood on the mat and for what? For that. The Answers World Championship.

Kawajai: You’re forgetting just what this means for Mr. DEDEDE though. Capturing the Answers World Championship tonight means that he’s the first and only one to capture the Answers World Championship, EAW Championship and World Heavyweight Championship! Mr. DEDEDE has held EVERY WORLD CHAMPIONSHIP in EAW history, included the Undisputed Harcore Championship!! He has etched his name in the history books! Mr. DEDEDE has captured all three EAW World titles!

Eddie Mack: What a career. What a competitor. What a champion.

(Mr. DEDEDE raises the Answers World Championship and holds onto his head as that’s the last image shown)

(Camera transitions to somewhere backstage where Tiberius Jones is shown stretching while Drake Jaeger lazily stabs a voodoo doll that looks like Aria Jaxon repeatedly with a pin)

Tiberius: Alright, I’ll buy.

(Tiberius stops stretching and looks at Drake)

Tiberius: Seriously, what’s with the doll?

Drake: Stabbin’ it.

Tiberius: Yeah, I can see that, but why do you have it?

Drake: Hoping it stabs Aria too.

(Tiberius stares at Drake in silence for a few seconds)

Tiberius: You know voodoo isn’t real, right? It’s bad enough we’re stuck wrestling in New Orleans, you don’t have to rub it in by entertaining their BS.

Drake: But I’m so boooorrreed..

Tiberius: Well, then do something more constructive with your time.

Drake: Like what?

Tiberius: I don’t know, figure out a good spot to put the Tag Team Grand Prix Trophy on our mantle after we win tonight.

Drake: Hold on, don’t you think you’re getting a bit ahead of yourself, TJ? I mean, we haven’t won anything yet. We’re up against two people that fought through 3 other tough teams to get to this point. Hell, you could say the teams they went through were even more of a threat in this Tournament than the ones we went through. I don’t think now is a good time to start taking all of this lightly. Tonight, we’re in for the fight of our lives. Tonight, the chips are down. Tonight, we go to war with no intention of coming back the same people we were coming in! Win or lose tonight, we make history!

(Drake and Jones look at each other in silence for several seconds before bursting into laughter)

Tiberius: Whew, you had me going there for a second.

Drake: I almost had you!

(The crowd pops as the camera pants to the right to reveal Corporate HRDO standing behind Drake. Tiberius points behind Drake, who startles and nearly falls off the chair he was sitting on as he stands next to Tiberius)

Drake: Don’t scare me like that! How the Hell are you so quiet for a guy that’s nearly seven feet tall?!

Tiberius: Well, well, well, look what we’ve got here. I see you’ve finally come to apologize to us for interfering in our match with Lucian and Senn. Say no more, HRDO, because your failure at stopping us from inevitably winning is all the apology we ever needed.

HRDO: …. Unfortunately, that’s not what I’m here for.

Tiberius: Oh? Then you must have come to congratulate us on our win tonight. Tell me, do you think we could, like, get a CUSTOM-MADE Trophy? I’m sure your’s is nice and all, but we were thinking something more along the lines of one with, you know, guns on it. Guns AROUND it. Maybe even a gun IN it.

HRDO: I really, truly, don’t want to be here around you two any longer than I have to. I’m not here for that either.

Drake: Are you here to tell us that Aria has been inexplicably stabbed multiple times?

HRDO: …. What?

Drake: This guy. If you’re not here to tell us something we WANT to hear, then WHY should we give a sh*t?

HRDO: I’ve come here to inform the two of you of a special stipulation for your bout tonight in the Tag Team Grand Prix Finals.

Tiberius: See, Drake? I told you he’d realize that Extreme Rules is the way to go, and all it took him to realize that was looking like an idiot trying to get in our way.

HRDO: Actually, I’d say it’s more the opposite. You see, not only is your match going to remain traditional wrestling rules, but I’ve also decided to ensure there’s no… Mishaps… By banning all other members of Hexa-gun from ringside.

Drake: BULLSH*T!

Tiberius: Look at this guy, thinking he can tell Hexa-gun what to do because he wore a crappy wig with a mask for years and pretended he was the spawn of Satan. This ain’t 2008 anymore, HRDO. What makes you think we’re gonna play by your rules?

HRDO: Because I said so.

Tiberius: Yeah? You and what army?

(HRDO smirks as several members of Quality Control suddenly surround a now uneasy-looking Drake & Jones)

HRDO: Do we have a problem here, boys?

(Drake & Jones say nothing as HRDO nods)

HRDO: I didn’t think so. Good luck tonight… You’re gonna need it.

(HRDO and Quality Control take their leave as Drake & Jones look on. Drake looks to make sure they’re out of sight)

Drake: Yeah…. Well…. I strongly disagree with your decision, BITCH!

Tiberius: …. Whatever, this doesn’t change a thing. We got this tonight!

Drake: Yeah…

Tiberius: We never needed any help anyway!

Drake: Yeah!

Tiberius: But just in case, let’s go look more into this voodoo crap.

Drake: YEAH!

(Drake kicks the air in the direction of where HRDO and Quality Control left before he and Tiberius take their leave)

( The camera cuts back to the ring where the Ring Announcer is standing by with a mic in hand. The lights dim a bit as the crowd starts cheering. )


Ring Announcer: Ladies and gentleman… This match is for the EAW SPECIALISTS CHAMPIONSHIP!!! The match stipulation this evening, by order of the Specialists Champion, Cailin Dillon, will be… A TABLES MATCH!!! The only way to win this match is to put your opponent through the table!

( The crowd gets ecstatic and begins chanting, ‘We want tables!’ Officials lay out tables around the ring as the chants from the crowd get even louder. )

Ring Announcer: Introducing to the ring first…

( A tornado quickly spins around on the tron, twirling around letters as it moves through. The letters blow into place to spell, ‘Cailin Dillon’ as “Tornado” by Little Big Town starts playing. Cailin comes strutting out with the Specialists title, reacting to the crowd with a smirk as she sticks one finger in the air before placing them on her hips and starting down the ramp. She walks up the ring steps and looks out to the crowd, scanning it with a smirk before she blows a kiss and then bends over to move through the middle rope. She gets in the ring and pumps a fist in the air as the crowd cheers and boos at the same time. )


Matt Ryder: Coming off a HUGE victory on Battleground with Aria Jaxon against Haruna and her partner, Cloud, Cailin has all the momentum to retain her title against Haruna!

( Cailin looks on at the ramp as the lights turn black. )

Ring Announcer: And her opponent…

( You hear a shout from on the ramp saying, ‘Minna-san, Moriagatteru ha yo~!’ Red colored light sticks light up the arena as they’re all raised up. “Dream Trigger” by Tokyo Performance Doll begins to play as Haruna makes her way to the ring with the crowd cheering and waving their red colored light sticks. )

Ring Announcer: AND THE CHALLENGER eighing in at one hundred and ten pounds… From Akihabara, Japan… =HAARRRUUNNNAAA SAAAKKKAAAZZAKKKKIIIIIII!!!!

Eddie Mack: What an entrance. The challenger is here and she looks determined to get her revenge for what happened on Battleground, and perhaps even win back the Specialists Championship!
( The EAW Official holds the EAW Specialists Championship up in the air and hands it over outside the ring. )

( Cailin and Haruna are standing face to face as the Referee signals for the bell. )


Eddie Mack: This is it! Tables match for the Specialists Championship! Both Vixens lock up in the middle of the ring and Cailin gets advantage with a headlock! Haruna pushes her off and sends her into the ropes as she’s now rebounding! No she grabs the ropes and Haruna went for a dropkick but missed! Cailin jumps on the ropes and flips connecting a springboard moonsault on a standing Haruna Sakazaki! What a way to get this match started! Remember the only way to win is if one of these Vixen’s puts the other through a table as Cailin pulls Haruna up and connects a standing hurricanrana and mounts on top of her throwing strikes at her face! Haruna slides under Cailin and connects a back heel kick to the back of her skull! What’s she doing now? She’s looking to end this! She’s sliding out of the ring and getting a table! She’s struggling to pick it up right now because it looks like she’s trying to rush. Cailin is up and rebounding against the ropes and Haruna has no idea… OH MY GOD CAILIN CONNECTS A CORKSCREW SPLASH RIGHT ONTO HARUNA DRIVING HER INTO THE BOTTOM STEEL OF THE TABLE!

Matt Ryder: HARUNA LOOKS LIKE SHE’S IN SOME TERRIBLE PAIN AFTER THAT! Cailin is slowly getting back to her feet now and pushes Haruna off the table. She grabs it and pulls it into the ring, then sets it against the corner turnbuckle. Cailin slides back out of the ring and walks over to Haruna and pulls her up. Haruna swats Cailin’s arms out of the way and starts throwing fists and elbows right into Cailin’s face, backing her up to the side of the ring. Cailin tries to fight back, but Haruna drives her shoulder into her gut and sends her back to collide with the edge of the ring! Haruna picks Cailin up and connects a scoop slam right into the ground! Haruna picks Cailin back up and drives her shoulder into her gut and drives her against our table! She’s taking Cailin’s back out and that’s a smart move immobilizing her like that! She’s picking her up again, this time whipping her and SENDS HER RIGHT INTO THE STEEL STEPS! OH MY GOSH, CAILINS SHOULDER HIT THOSE STEPS HARD! CAILIN’S DEFINITELY IN A LOT OF PAIN!

Eddie Mack: Haruna’s looking under the ring for something now… AND SHE PULLS OUT A STEEL CHAIR! She’s staring right at Cailin and she places the chair right against her face with her being in a seated position. Haruna steps back and charges with a dropkick! IT CONNECTS! HARUNA JUST KICKED THAT CHAIR RIGHT INTO HER FACE AND AGAINST THE STEEL STEPS! Haruna is showing no remorse tonight hoping to win back her Championship! Haruna grabs Cailin and rolls her into the ring. Haruna follows right behind her and isn’t giving her any space! Haruna grabs Cailin and whips her into the ropes, but Cailin hangs on! Haruna charges at her with a clothesline, but Cailin sends her outside the ring! This gives Cailin a chance to regain herself, but it looks like she’s looking for a high risk move right now! She holds her head to recover for a moment… but when she feels ready she runs at the ropes and jumps with a suicide dive! OH MY GOD NO! HARUNA HAD THE STEEL CHAIR IN HER HANDS AND BLOCKS THE DIVE WITH THE CHAIR IN MIDAIR!! CAILIN IS LAID OUT LIFELESS!

Matt Ryder: What a great move by Haruna to keep herself in this match! Haruna is grabbing another table and setting it up right next to Cailin who’s still not moving! Haruna looks down at her opponent and watches her suffer, if I didn’t know any better I’d think she was enjoying seeing her enemy suffer. As for the table Haruna’s got it all set up and now she sets Cailin right on top of it! Haruna is about to end this match already! She’s climbing in the ring now… AND SHE’S GETTING ON THE TOP ROPE! OH MY GOD! THE 360 SPLASH!! NO!! CAILIN ROLLS OUT OF THE WAY AND HARUNA DIVES RIGHT THROUGH THE TABLE! THE TABLE IS BROKEN RIGHT IN HALF! That doesn’t end the match since Cailin didn’t send her through it! This match continues! But it could very well have changed the tide of this contest permanently! Cailin is still trying to find some momentum to get back to her feet, still recovering from the previous chair shot to her skull. Haruna is still lifeless in between the broken table. Cailin is finally back to her feet and pulls Haruna out from the mess and whips her straight into the barricade! Haruna is now a seated position against the barricade and HERE COMES CAILIN DRIVING HER KNEE RIGHT INTO THE SKULL OF HARUNA! HARUNA’S HEAD IS DRIVEN RIGHT INTO THE BARRICADE! Cailin grabs Haruna and sends her into the ring!

Eddie Mack: Cailin grabs the table and looks down at Haruna…. she’s muscling up that table to hold it over her head and she BRINGS IT DOWN! SHE’S DRIVING THE TABLE RIGHT INTO HARUNA’S CHEST! NOT ONCE! NOT TWICE! NOT THREE TIMES! BUT FOUR TIMES SHE DRIVE’S THE TABLE STRAIGHT INTO HER CHEST! SHE SETS IT AGAINST THE ROPES AGAIN! Cailin picks Haruna up and goes to whip her into the table, but Haruna reverses and sends her instead! She stops herself before she collides with the table! Cailin comes charging at her! HARUNA CONNECTS A SPINNING BACK HEEL KICK TO STOP CAILIN MID STEP AND DROPS HER TO THE GROUND! Now Haruna sluggishly grabs the table and sets it up near the corner turnbuckle! This is looking like it’s coming to an end here soon with these actions! Haruna has it set up and pulls Cailin to the corner turnbuckle! She lifts her up to the top and throws a couple punches at her face to wear her opponent down…. now check this out… check this out…. Haruna climbs to the top rope now… UHHH OHHHH, THIS ISN’T GONNA BE GOOD FOR EITHER VIXEN NO MATTER WHAT HAPPENS!



( “Tornado” by Little Big Town blasts through the speakers as the crowd erupts for Cailin Dillon while she’s getting back to her feet. An Official hands over the Championship to the referee and the ref helps Cailin to her feet and hands her the EAW Specialists Championship. )


Matt Ryder: WHAT A MATCH THESE TWO VIXENS PUT ON HERE TONIGHT BROS! Oh man, Cailin showed up tonight and finished this match in a very stylish way, inverting her finisher and connecting it through the table to keep what’s hers!!

( Replays from the match are aired )

Eddie Mack: Cailin showed the talent she possesses to be a worthy Champion and live a long reign as the Specialists Champion, but Haruna had one hell of an effort and put on a hell of a match here tonight herself! She should not be ashamed of herself.

(The camera goes to the backstage inside the offices of EAW Chairman Zack Crash, as he prepares of the Elimination Chamber Match to come. The door opens as a Staff member entering the room as he stands in front of the door.)

Zack Crash: What is it?

Staff Member: There’s someone here to see you.

Zack Crash: …… Then let them in.

Staff Member: There’s a problem.

Zack Crash: What?

Staff Member: It’s Jacob Senn.

(Zack Crash looks to the Staff member with a glare of shock and dread as he walks up to the Quality Control member while being in his face.)

Zack Crash: You listen to me, and you listen good. You stay in this room right in that corner and have security guys sitting outside of that door. If he tries something, I want to make sure he gets taken out of the equation tonight! You got that?

Staff Member: Yes, sir.

(The staff member calls for a few more security guards before he escorts Jacob Senn into the room, as he looks with confidence at his greatest rival.)

Zack Crash: What do you want, Senn? Come to give some last words before I send Dynasty Wrestling to the grave?

Jacob Senn: No. Because Zack, I know either Lucian or myself will get the job done inside of the Elimination Chamber. But, I’m not here to talk about that.

Zack Crash: Then, why are you here?

Jacob Senn: See, I know you better than anyone on this roster, Crash. There’s no man who knows the inner workings of that mind better than me, and guess what? I know that no matter the result of this match, you won’t give up. So, I intend to make sure you are stopped.

Zack Crash: And how do you intend to do that?

Jacob Senn: Simple. There’s a show after Road to Redemption, the EAW Awards Show, and even though the awards will be the main focus, it will be the end of Zack Crash. I intend to end you, once and for all, and finish what I started years ago in our legendary match on this show.

Zack Crash: You want to face me at the EAW Awards Show???? Fine. I will be happy to humiliate you twice in a row, now if you could–

Jacob Senn: Great. Because our match won’t be just any match, bud. It will be… a Glass Crypt Match!

(Zack Crash’s face shoots up in shock, right before a devilish grin arises from his face as he shakes hands with Jacob Senn.)

Zack Crash: I accept. Trust me, Senn, this will be a decision you truly regret.

(Jacob Senn is allowed to leave the offices of Zack Crash, as Crash goes back to preparing for his match.)

( Highlights play of the Mexican Samurai/Dark Demon feud, flashing back to Showdown: Redemption with Mexican Samurai destroying Pizza Boy in an I Quit Match and Dark Demon destroying Diamond Cage in a Cage of Death match, flashing to Dark Demon and Bryce Dean celebrating on the next Showdown with Samurai challenging Dark Demon to a match and being turned down only for James Shields to announce they would be forced to team in the Grand Prix tournament, with the duo advancing to the semi-finals with Dark Demon walking out on the match with Stand & Deliver but Mexican Samurai winning the match anyway, with Dark Demon turning on Samurai at the semi-finals against Kennedy and Aria, the following week seeing Mexican Samurai call out Demon again and Demon accepting )

( Camera returns to the arena )

( ‘’Forever and a Day’’ by High Contrast plays as Mexican Samurai makes his way out onto the stage, wearing blue MMA gloves, elbow pads, knee pads and wearing trunks covered with various sponsors as Samurai begins to make his way down to the ring, looking confident as he pumps himself up at the bottom of the ramp before entering the ring, doing a few warm-up ‘’laps’’ around the ring )

Matt Ryder: Here we go broski! This is by far THE biggest match in the career of the Mexican Samurai, we’ve seen Dark Demon do a lot of trash talking in his career but I don’t think he’s ever gone up against anybody who has given him as much trash talk back as Mexican Samurai has done, who has vowed to do the ‘’impossible’’ and defeat Dark Demon here tonight and becoming the first man since Xavier Williams to do so.

Jake Mercer: Mexican Samurai is an expert at striking, at the ground game and we KNOW from his match with The Pizza Boy just how ruthless and aggressive that he can be. But as you said this is THE biggest match in the career of Mexican Samurai so far, he’s talked a lot but he can back it up? Can he overcome the pressure that comes with facing Demon? We will find out now …

( A large platform can be seen at the top of the ramp with Sinead O’Conor on it as the lights in the building begin to fade to colours of Green, White and Orange as ‘’The Foggy Dew’’ begins to be performed )

‘Right proudly high in Dublin Town, hung they out a flag of war’

( A camera is shown backstage as Bryce Dean is shown coming out of a locker room followed by Dark Demon, wearing green and gold trunks and black MMA gloves with the EAW Hall of Fame Championship around his waist with an Irish flag draped over his shoulders )

‘T’was Better to die neath an Irish sky’

( Dark Demon can be seen shadow-boxing as he walks down the long hallway before making his way to the curtain )

‘And from the plains of Royal Meath, Strong men came hurrying through, while Brittania’s huns with their long range runs, Sailed in through the Foggy Dew’

( Dark Demon makes his way onto the entrance ramp with Bryce Dean to a chorus of boo’s as Dean and Demon make their way down the ramp )

‘Their bravest fell and the requiem bell rang mournfully and clear’

Matt Ryder: And here comes Dark Demon, flanked with his agent Bryce Dean, Demon hasn’t been pinned or submitted since he last fought Xavier Williams in November of 2014, since his return to EAW, I don’t think we’ve EVER seen him as dominant and as ruthless as he is in this run, he’s never even been in a situation where it looks like he might lose or that his opponent is even slightly in control, it’s a level of dominance that we’ve never seen before.

‘While the world did gaze with deep amaze, At those fearless men but few, Who bore the fight that freedom’s light, Might shine through the foggy dew’

Jake Mercer: We’ve never had anybody who just seems to trash talk as much as this guy does, the self-confidence, the aura, the presence, it’s a huge factor into why Demon doesn’t lose, according to him he has his opponents beaten before the match even begins. The thing, is can he do it again? Can he close 2015 undefeated?

( Dark Demon enters the ring with Bryce Dean as the lights return to normal as the ring announcer enters the ring )

Ring Announcer: Ladies and gentlemen, the following contest is scheduled for ONE FALL! First, in this corner …he is from San Jose, CA and has weighed in tonight at 210 pounds …HE IS THE ‘’UNWRESTLER’’’ ….THEEEEEE MEXXXXXXIIIIIIIIIICAAANNNNNNNNNNN SAMUUUURAAAIIIIIIIII!!!!

( Bryce Dean takes the microphone away from the ring announcer )

Bryce Dean: Ladies and gentlemen …In this corner, he is hailing from the greatest city in the greatest nation in the world; Galway, Ireland, he is weighing in at a lean 185 pounds and he is the REIGNING! UNDISPUTED! EAW HALL OF FAME CHAMPION ….THE SLAYER OF THE HEART BREAK FAMILY, THE CAMERON ELLA AVA FAMILY, THE DIAMOND CAGE FAMILY AND SOON TO BE MEXICAN SAMURAI FAMILY, THE ‘’NOTORIOUS’’ ….DAAAAAAAAAAAAAAAAAAAAAAARRRRRRRRRRRRKKKKKKKKKKKK DEMMMMMMMMONNNNNNNNNNNNNNNNNNNNN!!!!!!!!!!!!!!!!!!!!

( Both men go face to face in the middle of the ring staring each other down as the referee tries separating them )

Dark Demon: I can smell his pussy from here! What you got to say now, face to face?! What you gonna do you little bitch?!

Matt Ryder: The referee is separating them both back to their corners as he demands Dean to leave, but Demon just can’t shit-talking Mexican Samurai …

( Ding! Ding! Ding! )



Matt Ryder: NO!!!!!! MEXICAN SAMURAI GETS THE SHOULDER UP!!! OH MY GOD, THAT WAS ALMOST OVER IN 13 SECONDS!!! Samurai is down on the mat as Demon springs up right to his feet and begins stomping all over Mexican Samurai, taunting him and begins taunting the crowd, flipping them off! Demon is stalking Samurai who is using the ropes to slowly lift himself up, he may have already suffered a concussion or God knows what as he is up on his feet but looks groggy as Demon WITH A ROLLING ELBOW ON MEXICAN SAMURAI!!!!! BUT SAMURAI COUNTERS IT WITH A MUAY THAI KICK TO THE HEAD!!!! Demon stumbles backwards as Mexican Samurai is still groggy on those ropes but he comes forward and sends another muay thai kick into Demon, this time into the legs as Mexican Samurai CONNECTS WITH A HUGE HAYMAKER ON DEMON!!! But Demon just stands there and laughs, ‘’is that it?!’’ before sending a jab of his own at Mexican Samurai! Mexican Samurai stumbles backwards as Demon knees him in the mid-section and Irish-whips him off the ropes as Mexican Samurai comes back and Demon nails him with a MAFIA KICK! Mexican Samurai falls to the ground as Demon gets down on top of him and begins smashing him with ground and pound!


Matt Ryder: Samurai rolls out of the ring in pain as Demon is on the mat, breathing heavily and wanting clutching his arm as Dean is stomping on Samurai as the referee is checking on Demon! C’mon bro! Samurai is slowly lifting himself up with the apron as Demon is getting up and shoots himself off the ropes —- TOPE CAN DEMON!!!! SOMERSAULT DIVE THROUGH THE MIDDLE ROPE!!! BUT SAMURAI MANAGES TO CATCH DEMON IN HIS ARMS – SAMURAI CONNECTING WITH A POWERSLAM THAT SENDS DEMON INTO THE APRON!! DEMON IS SENT CRASHING INTO THAT APRON AND LANDS AWKWARDLY ONTO THE RINGSIDE FLOOR!!! Demon is down on the floor as Samurai lifts him up and THROWS DEMON’S BODY RIGHT INTO THE BARRICADE!!! DEMON IS DUMPED ON THE GROUND AGAIN!! Mexican Samurai once again lifts up Demon and SMASHES DEMON HEAD FIRST INTO THE STEEL RINGPOST!! DEMON GOES DOWN AGAIN!!!! Mexican Samurai rolls back in and out of the ring, breaking the count as he grabs Demon up and brings him towards our table ….RAMMING THE HEAD OF DEMON INTO OUR TABLE!!!! OVER AND OVER AND OVER AGAIN!!!! DEMONS FACE IS BEING IMPRINTED INTO THE COVER OF THE TABLE!!! MEXICAN SAMURAI NOW GRABS DEMON AND RAMS HIM SPINE FIRST INTO THE EDGE OF THE RING!!!! DEMON FALLS STRAIGHT DOWN ONTO THE FLOOR, I HAVE NEVER SEEN DARK DEMON GET DOMINATED LIKE THIS BEFORE!!! I HAVE NOT SEEN HIM GET DOMINATED IN OVER A YEAR!!!


Jake Mercer: Samurai now lifts up Demon and rolls him into the ring, Samurai is still a bit groggy from that Hangman’s Elbow but Samurai doesn’t want to go for the pin here, he wants to inflict MORE damage on Dark Demon …Samurai lifts Demon up to his feet and pulls him in — CONNECTING WITH A HUGE POWERBOMB ON DEMON SENDING HIM CRASHING INTO THE MAT!!! SAMURAI LIFTS DEMON UP AGAIN AND CONNECTS WITH A SECOND POWERBOMB IN A ROW ON DEMON!!!!!! SAMURAI NOW LOOKING FOR THE PIN!!!!!

Ref: ONEEEEEEEEEEEEE!!!!!!!!!!!!!!!!!!!! ………….TWOOOOOOOOOOOOOOOOOOOO!!!!!!!!!!!!!!!!!!!!!!! …………NO!!!!!!!!!!!! DEMON KICKS OUT!!!!!!!!!!!!!!!!!

Matt Ryder: DEMON JUST BARELY KICKS OUT OF IT!!! Samurai smirks as he knows he gets to put more pain on the Hall of Fame Champion as he lifts Demon up by his head but look at this! Bryce Dean gets onto the apron and is shouting at Mexican Samurai! Samurai walks towards Dean and GRABS DEAN BY HIS SUIT COLLAR AND THROWS HIM INTO THE RING! DEAN’S EYES OPEN WIDE AS HE REALISES WHAT IS GOING TO HAPPEN AS SAMURAI IS STALKING HIM, THE REFEREE IS TRYING TO GET DEAN OUT OF THE RING AS —DEMON LOW BLOWS MEXICAN SAMURAI BEHIND THE REFEREE’S BACK!!! SAMURAI DOUBLES OVER IN PAIN AS DEMON ROLLS HIM UP!!!!!!!!!! OH C’MON!!!!!!

ONEEEEEEEEEEEEEEE!!!!!!!!!!!!!!!!! …………TWOOOOOOOOOO!!!!!!!!!!!!!!!!! ………





Jake Mercer: AND DEMON JUST BREAKS IT UP BEFORE THAT FIVE COUNT! Samurai is down on the mat and rolls out onto the apron, trying to get a breather here and regain his senses but Demon isn’t going to let him as he gets him up on the turnbuckle, this isn’t very characteristic of Demon as HE LEAPS OFF THE TURNBUCKLE AND CONNECTS WITH A DOUBLE LEG STOMP ON THE HEAD OF MEXICAN SAMURAI WHO WAS LAYING ON THE APRON!!! BOTH MEN CRASH TO THE FLOOR!!!!! Samurai is still down as Dean runs over and Demon is on his knees, wait a second, Demon is looking underneath the ring …he does know this isn’t a No DQ match?! Dean is lifting Samurai up to his feet as OH NO!!!! DEMON PULLS OUT THE RAILROAD SPIKE!!!!! DARK DEMON HAS THE RAILROAD SPIKE IN HAND AS DEAN IS LIFTING SAMURAI UP, OH NO!!!! PLEASE NO!!!!! DEMON NAILS SAMURAI IN THE FOREHEAD WITH THE RAILROAD SPIKE!!!! OH MY GOD!!!!! SAMURAI GOES DOWN, HE’S PISSING BLOOD!!!! THE REFEREE RINGS THE BELL, DARK DEMON HAS BEEN DISQUALIFIED!!!!

( Ding! Ding! Ding! )

Ring Announcer: Here is your winner by DISQUALIFICATION ….MEXIICCCAANNNN SAMURAI!!!!!!!


( Several EMTS come running down, checking on Samurai who isn’t moving but drenched in blood )

Jake Mercer: This isn’t good, Mexican Samurai was dominating Dark Demon in a way that we have never seen in a long time and Demon took the easy way out this isn’t good ….

( Camera fades backstage as Ryan Savage is seen pacing back and forth backstage, throwing a tantrum… picking up a chair and throwing it right into the segment station television. Dynasty owner John Conning is seen coming as Savage continues his tantrum. )

Conning: Well, well… well. Why am I not surprised, that when I hear one of my talents is sabotaging the backstage area, that it is in fact you. What is it this time, Ryan?

Ryan: Don’t you mock me.

Conning: And don’t you tempt me. But have no fear, I am not your enemy. I apologize the chamber did not go your way… but this isn’t —


Conning: Well, I know your history with him. You’re entitled to your opinions and feelings. But I sadly cannot help you, for Mr. DEDEDE now resides on Voltage, out of my reach.


Conning: Save it. Fine. You have my permission to leave.

Ryan: Really… you’re willing to let me go to Voltage just like that?

Conning: We all have our own desires… But just remember. You’ll owe me one. Best of luck, I guess.

Ryan: *chuckles* … Well, if your company doesn’t become property of Zack Crash I’ll be happy to bring Mr. DEDEDE back to you. Just… not in one piece.

( Ryan Savage gives him a slick grin as the camera fades back to ringside. )

(Camera transitions back to the ring where the Ring Announcer stands next to a large Tag Team Grand Prix Trophy with a spotlight shone on it)


Announcer: The following Tag Team contest is scheduled for ONE fall!…. AND IS THE FINALS IN THE EAW TAG TEAM GRAND PRIX!!!….. Introducing team number one…

(“I Don’t Care” plays all throughout the arena as Brett Kennedy and Aria Jaxon make their way out to the stage in matching red attire)

Announcer: Making their way to the ring… Weighing in at a combined weight of 385 Pounds!…. THEY ARE THE TEAM OF…. ARIA JAXON…. AND BRETT KEEENNNNNNEEEDDDDDDYYYYYYYYYY!!!….

Kawajai: I’ve been waiting for this for a long time! The conclusion to EAW’s first ever Tag Team Tournament comes to a head here tonight as I’m joined here with Matt Ryder to call this one!

Matt: I’m already on the edge of my seat and the match hasn’t even started, bro, I’ve kept my eyes glued to this Tournament as we’ve watched only TWO Teams emerge out of 16 of the best EAW has to offer!

Kawajai: Well these two could be considered the underdogs here in comparison to their opponents tonight, but both Aria Jaxon and Brett Kennedy have both proven on their own and as a team that they’re a force to be reckoned with in their own right! They’ve gone through the best EAW has to offer and tonight, it could culminate for them by winning the Grand Prix and getting a future Tag Team Title shot!

(“Bite The Bullet” by contRoVersy plays all throughout the arena as Drake Jaeger – dressed in green and black – makes his way out to the stage next to Tiberius Jones – dressed in blue and black and carrying a flag with the Hexa-gun logo on it)

Announcer: And their opponents!…. Making their way to the ring…. Weighing in at a combined weight of 408 pounds!…. REPRESENTING HEXA-GUN…. DRAKE “THE TERMINATOR” JAEGER… TIBERIUS JONES…. THEY ARE DRAKE! AND!! JOOOOOOONNNNNNEEEESSSSSS!!!….

Matt: These two come out of the blue and so far, as much as I hate to admit it, they’ve dominated big time along with the rest of Hexa-gun!

Kawajai: I can’t deny that either – these two men are very talented. Tiberius has been around for well over a year now and a former National Elite Champion – he knows his way around a ring even better than his two opponents tonight and his somewhat enigma of a partner in Drake Jaeger certainly isn’t a slouch either.

Matt: I don’t know which way this’ll go, Kawa, but I’m happy to sit back and call it! Let’s get to it!

(Both teams stare at the Grand Prix Trophy from opposite sides before the Referee takes it and hands it off to someone at ringside and calls for the bell)


Kawajai: This Finals bout is finally underway as Drake looks to volunteer for his team while it seems as though Aria could be the one starting this off as she may be strategizing real quick with Brett from the apron… Brett seems a little bit concerned, but it looks as though Aria’s ready to do this as she–

Drake (no microphone): YAMCHA’D!!!!


Referee: ONE!!!!!!!……… TWO!!!!!!!!!……….. THREE!!!

Kawajai: NO, DRAKE GRABS THE BOTTOM ROPE TO BREAK IT AND IMMEDIATELY PULLS HIMSELF TO THE OUTSIDE! THE REFEREE WAIVES IT OFF! Unbelievable! What a superkick that was and right out of nowhere as Aria looks at Drake with a smirk on her face! Drake is absolutely livid as he paces on the outside! Aria’s telling Drake it was THAT close! A little taste of his own medicine as Tiberius jumps down to calm his partner…

Referee: ONE!….. TWO!…….

Matt: It looks like Drake regained his, uh, composure as TJ gets back up on the apron and Drake cautiously enters the ring… Aria looks lit up and ready to go! Drake looks none too pleased with how this contest has already started off as he glares at her… And he tags in Tiberius! Jones jumps over the ropes and into the ring as he and Aria circle the ring right away… Jones inviting Aria in for a potential lock up… She doesn’t look too trusting about it, but slowly makes her way… They lock up with one hand… Looking–Tiberius pulls her in for a side headlock! Aria’s quick to slip out of it! Tiberius isn’t letting her get off that easy as he disrespectfully grabs her by the hair and slams her down to the canvas! Come on!

Kawajai: The Referee looks none too happy about that! HOLD ON–ARIA WITH A KIP UP! TJ’s too surprised to stop her from immediately grabbing his left arm, weaving under, and wrenching it! Aria just YANKS the arm of TJ as he cringes in pain! ANOTHER hard yank on the arm as she could be looking to completely dislocate it! TJ’s doing his damndest to get out of this! Aria’s navigating her opponent over to her team’s corner to tag in Brett! No–TJ isn’t letting it happen as he overpowers Aria over to the ropes! Aria jumps to the middle rope with TJ’s arm still in her grasp! A BIG FLYING ARMDRAG CONNECTS BY ARIA AS TIBERIUS IS SENT ACROSS THE RING! TJ quickly scrambles to his feet as Aria comes charging with a full head of steam! TJ’s got it scouted as he swings with a clothesline, but Aria ducks under and charges up to the corner behind him! TJ turns around as ARIA LEAPS! HE CATCHES ARIA! TJ SHIFTS HER ONTO HIS SHOULDERS! Aria’s quick to escape it as TJ quickly turns around to get caught in a side headlock takedown! Jones wraps his legs around the head of Aria for a headscissors to counter it! Aria shows off her flexibility as she maneuvers herself in front of TJ, picks her body up in the air from the canvas, and YANKS herself away out of the legs of Jones!


Referee: ONE!!!!


Referee: ONE! TWO!

Matt: Aria has no choice but to break it up! What a back and forth battle that was! Aria’s on fire here and she KNOWS it! She’s got both Tiberius Jones and Drake Jaeger where she wants them! A furious-looking Tiberius Jones slowly pulls himself back up to his feet, against the ropes… HOLD ON–DRAKE JAEGER PULLS BRETT KENNEDY OFF THE APRON! BOTH MEN START THROWING FISTS INTO ONE ANOTHER! THE REFEREE TRIES TO GET THEM TO BREAK IT UP! JONES EXPLODES OFF THE ROPES AS ARIA LOOKS AT THE ENSUING FIGHT ON THE OUTSIDE FOR A MOMENT AND GETS TAKEN OUT WITH A HEINOUS LARIAT!! ARIA COULD BE OUT COLD AFTER THAT! What a hit she just took! The Referee seems to have gotten Drake and Brett away from one another as Jones lays into Aria with a series of stomps! The Referee tells TJ to cool it with that assault as Drake gets back up on the apron and volunteers to tag back in… TJ obliges as he tags Drake back into this match, who gleefully enters and wastes no time rushing over to Aria! He starts laying into her with vicious lefts as Aria does all she can to defend herself!

Kawajai: You’ve got to expect anything from Drake & Jones, they’ll go to any length just to turn the tide in a match and that’s exactly what we saw here as Drake successfully distracted Aria! The Referee makes Drake back away from that series of shots… But he’s quickly back on the attack! Aria’s doing all she can to get back to her feet and back into the match as Drake now just mocks her with slaps to the head!


Matt: Drake with some… Questionable trash talk as he mocks and disrespects her… Brett looks look he’s about to explode as he has to watch this from the apron… Drake grabs Aria by her hair and slowly drags her back up… He sends the Empress of Elite straight into his team’s corner with a big Irish whip! HE COMES CHARGING LIKE A FREIGHT TRAIN RIGHT AFTER HER! ARIA SLAMS HARD INTO THE CORNER AS DRAKE COMES IN! ARIA PUTS A BOOT UP AS IT CONNECTS WITH THE MOUTH OF DRAKE! SHE CHARGES OUT OF THE–JONES GRABS ARIA BY HER HAIR AND PULLS HER BACK AS THE BACK OF HER SKULL NAILS THE MIDDLE TURNBUCKLE! It looks like Drake got a busted lip from that boot of Aria’s as he realizes he’s bleeding and rushes into Aria with a boot to the face! Another boot! ANOTHER! Drake presses his boot straight into the throat of Aria to choke the life out of here while Jones presses his own boot against the back of her head!


Kawajai: Drake and Jones break the choke on her before Drake grabs her by her hair once more to drag her up… Oh no… He’s setting her up on the top turnbuckle! Drake’s looking for something big as he climbs up there! Drake’s literally laughing in her face as he sets her up… ARIA WITH A HARD RIGHT HAND TO THE GUT OF DRAKE! ANOTHER STIFF SHOT! SHE HEADBUTTS HIM! JONES GRABS HER FOOT, BUT SHE MANAGES TO CATCH HIM WITH A FOOT TO THE FACE AS HE DROPS DOWN ON THE APRON! SHE SLIDES BETWEEN THE LEGS OF DRAKE! SHE’S GOT HIM ON HER SHOULDERS?! WHAT?! SHE’S RUNNING WITH DRAKE ON HER SHOULDERS!! NO WAY–TURNBUCKLE BOMB CONNECTS INTO ARIA’S TEAM AS DRAKE’S HEAD WHIPLASHES OFF THE TOP TURNBUCKLE!! ARIA MAKES IT TO THE TAG TO BRETT KENNEDY!

Matt: Drake is dazed and confused as he stumbles out of the corner as fast as he can as he realizes he’s in trouble! He’s trying to his best to get to his corner for the tag, but Jones is still hurt! Drake realizes exactly how much trouble he’s in as he reluctantly turns around to Brett Kennedy perched on the top turnbuckle! HE LEAPS! A VICIOUS FLYING CLOTHESLINE CONNECTS AS DRAKE JAEGER IS LAID OUT! BRETT IMMEDIATELY COVERS HIM!

Referee: ONE!!!!……. TWO!!!!!!!!…..

Kawajai: Jones jumps in from out of nowhere to break it up! He throws multiple clubbing blows into Brett, but Brett’s fighting back! He’s about had as much as he can take of Hexa-gun over these past few months! He’s not letting them turn this around on him! Both men make it to their feet as they continue to throw lefts and rights into each other! Jones stops it with a stiff knee to the stomach of Brett! He grabs Brett and sends him away with a big Irish whip! No–Kennedy reverses it! ARIA PULLS THE TOP ROPE DOWN AS JONES GOES GLIDING OVER IT BACKWARDS AND CRASHING AND BURNING ON THE OUTSIDE!! Kennedy turns his attention back to Jaeger as Jones seems to be out of the equation! Drake is trying to slink away as Brett sets his sights back on him! Drake is backing into the corner, pleading for mercy as Brett slowly makes his way towards him… BRETT PICKS UP SPEED AND COMES AT HIM FULL FORCE WITH A BOOT TO THE FACE! NO–DRAKE MANAGES TO DODGE IT AS HE ROLLS OUT OF THE WAY! DRAKE SWINGS FOR BRETT AS HE TURNS AROUND, BUT HE’S CAUGHT WITH A HIGH KICK TO THE BACK OF THE SKULL FROM ARIA OUT OF NOWHERE! ARIA PULLS DRAKE IN FOR A POTENTIAL BACKDROP DRIVER! DRAKE’S FIGHTING IT! BRETT WITH THE BUCK STOPS HERE!!! THAT BIG BOOT CONNECTS TO THE FACE OF DRAKE JAEGER AS ARIA USES THE MOMENTUM TO CONNECT WITH AN IMMEDIATE BACKDROP DRIVER!!! WHAT A COMBINATION!


Referee: ONE!!!!!!!………


Referee: TWO!!!!!!!!!!……….

Matt: JONES OVERPOWERS ARIA AS THEY BOTH FALL INTO THE PIN ATTEMPT TO BREAK IT! THIS ISN’T OVER YET! Jones and Aria scramble to get back to their feet after that one and lay into one another! The Referee’s having a Hell of a time trying to keep order here! Aria quickly takes control with a powerful forearm off the face of Jones! Another forearm connects! SHE PULLS JONES IN AND SIGNALS FOR THE HOLLYWOOD HANGOVER!! SHE–NO–JONES SLIPS OUT OF THE BULLDOG POSITION AND SENDS ARIA CRASHING HEAD-FIRST INTO THE RINGPOST OF A NEARBY CORNER!! Aria drops to the outside in pain as Jones turns around! He’s met with a left from Brett Kennedy! A right connects! HE PULLS JONES IN!! BRIDGE CITY CUTTER!!!! JONES FORCES HIM OFF AND ONTO THE AWAITING SHOULDERS OF A REVIVED DRAKE JAEGER!! DRAKE QUICKLY TURNS AROUND AS BRETT STRUGGLES! JONES LOCKS THE WAIST OF DRAKE?! GERMAN SUPLEX-AIDED SAMOAN DROP?!!!! IT CONNECTS PERFECTLY AS BRETT IS DRIVEN INTO THE CANVAS!!

Kawajai: It seems as though the tables have completely turned here! Drake & Jones are back in the driver’s seat as Drake yells for Jones to get Aria for something big! I can’t imagine what these two sociopaths have in mind as Jones rolls to the outside, grabs a potentially injured Aria, and sends her rolling back in… Drake lays into a downed Brett with several hard shots before pulling him up… Both men navigate their opponents to opposite sides of the ring and pick them up in running powerslam positions! THEY COME CHARGING AT ONE ANOTHER WITH ARIA AND BRETT IN TOW!! BRETT SLIDES OFF THE SHOULDERS OF DRAKE AS JONES SUCCESSFULLY LAUNCHES ARIA–SHE CATCHES DRAKE WITH A TEXTBOOK TORNADO DDT AS JAEGER IS SPIKED STRAIGHT INTO THE CANVAS!!! I CAN’T EVEN COMPREHEND WHAT JUST HAPPENED! JONES DOESN’T SEEM TO KNOW WHAT JUST HAPPENED AS BRETT KENNEDY COMES CHARGING IN WITH A HUGE DROPKICK THAT SENDS JONES FLYING BACK INTO THE CORNER!!


Matt: A damaged TJ rolls to the outside to join his partner as they think of what to do next…

Referee: ONE!!……. TWO!!………


Referee: SEVEN!!………..

Kawajai:THE CROWD LITERALLY BRINGS ARIA BACK TO THE BARRICADE AS SHE STANDS UP ON IT! DRAKE TURNS AROUND AS SHE LEAPS–HURRICANRANA!!! DRAKE IS WHIPPED INTO THE MAT WITH GREAT FORCE AS THAT HURRICANRANA CONNECTS!! Brett Kennedy takes control in his struggle with Jones as he sends him spine-first into the ring apron! Jaxon pulls a damaged Drake Jaeger up and sends him rolling back into the ring to break up the Referee’s count! Brett sends Jones straight into the barricade with another powerful Irish whip before rolling back into the ring to perhaps finish this match! Aria wants to finish this herself and it looks like Brett has no problem with it as he tags her in! Aria quickly gets back into the ring and stalks her opponent as a battered Drake Jaeger slowly makes his way up… SHE SWINGS A HARSH KICK INTO HIS RIBS! ANOTHER KICK TO THE SIDE OF THE HEAD! DRAKE CAN BARELY DEFEND HIMSELF AS SHE NAILS HIM WITH A ROLLING BACKFIST! ARIA NOW WITH MULTIPLE OPEN-PALM CHOPS ACROSS THE FACE OF A WOOZY DRAKE! SHE FINALLY PULLS HIM IN!! SHE SENDS HERSELF UP!! CODE RED!!!! THE CODE RED EMPHATICALLY CONNECTS AS DRAKE JAEGER IS LAID OUT!!! HE’S FINISHED HERE!! SHE COVERS HIM!!!

Referee: ONE!!!!!!!!……. TWO!!!!!!!!!!………



Referee: ONE!!!!!!!…….. TWO!!!!!!!!!……..



Kawajai: Drake stops the assault, but the damage is already done! Aria’s been busted open after that! Drake helps Tiberius back up and quickly goes back to his team’s corner as he tells him to end this… Tiberius tags Drake in… TJ slowly gets out to the apron as Drake grabs a hold of Aria… He slowly pulls her up by her hair… Picking her up in an electric chair position! THIS IS IT!! KILLSHOT!!!! THE BUCK STOPS HERE?!!! BRETT KENNEDY RUSHES IN OUT OF NOWHERE WITH THAT VICIOUS BIG BOOT TO THE FACE OF DRAKE!!! ARIA SEIZES THE MOMENT WITH A VICTORY ROLL ON JAEGER!!!

Referee: ONE!!!!!!!!!……….


Referee: TWO!!!!!!!!!………


Referee: THREE!!!!


Referee: ONE!!!!!!!!…….. TWO!!!!!!!……..



Referee: ONE!!!!!!!!





(“Bite The Bullet” by contRoVersy plays all throughout the arena as Tiberius Jones drags Drake Jaeger out of the ring to celebrate while a still hurt Brett Kennedy slides back into the ring to check on Aria Jaxon)

Kawajai: What a match! What a truly, unbelievable tag team match! Aria Jaxon and Brett Kennedy did absolutely EVERYTHING – AND I MEAN EVERYTHING – in their power to win this match! They laid it all on the line tonight, but Drake and Jones managed to just barely take it from them in the end! They should still be proud of what they did here tonight!

Matt: And congratulations to Drake Jaeger and Tiberius Jones! Those two men didn’t necessarily play fair, but they got results tonight in the form of that beautiful Trophy! They may not want to admit it, but Brett Kennedy and Aria Jaxon just took them to their absolute LIMIT tonight!

(Drake and Jones hold up the Grand Prix Trophy on the ramp as Brett Kennedy and Aria Jaxon speak to a Doctor in the ring while the fans cheer for them)

Kawajai: Like I said, they have no reason to be ashamed in their performance tonight. They may have come up short in this, but they proved beyond a shadow of a doubt that they’re two of the best young competitors this company has to offer and you can guarantee they’ll be back for revenge!

Matt: No doubt about it, Kawa, no doubt about it! Congrats on both teams for such a stellar match! THAT was a testament to how much this division has evolved and I look forward to seeing way more!

(The camera cuts to a bloody Xavier Williams sitting on a chair in his locker room, almost emotionless.)

Xavier: I had it.

(Xavier suddenly shoots up to his feet, grabs the chair and throws his against the wall.)


(Hitchman grabs the chair and sets it back up.)

Hitchman: Calm down, Xavier. We both know well enough that this is all far from over – Minns can’t hide forever. For the first time, we had an element that we couldn’t prepare for.

Xavier: Think about it, Albert, what other opportunity is there going to be?! You think that James Shields is going to give us anything?! Please. James Shield has Thomas Minns’ (CENSORED) so far down his throat that there’s going to be NOTHING for us.

(The hint of a smile crosses the face of Hitchman.)

Hitchman: Have a little faith – you should know this by now. With the right attitude, James Shields can be rather reasonable. Think about it, if it wasn’t for him, we would probably have Hades as the EAW Champion. Don’t forget that it was Shields that made sure that the match between the two of you happened at Midsummer Massacre.

(Xavier Williams shakes his head.)

Xavier: Make sure it happens then, Albert – my patience is running REAL thin.

(Hitchman starts to make his leave.)

Hitchman: As I said, just have a little faith.

(Hitchman leaves as Xavier grabs another chair and throws it against the wall )

( Advertisements )

( The camera cuts back to the massive arena.)

( Camera returns to the arena as appears on the screen and the Elimination Chamber descends from the rafters, fully repaired from the previous matches. )

Stew: Ladies and Gentlemen it is now time for what may be the most important match in the history of EAW! It will decide the fate of the future of our company, it will decide if the ruling class remains or if there will be a new regime introduced! Let’s take a look at how everything came about.

( Epic recap video plays of the Dynasty Wrestling vs EAW Zack Crash regime, starting at Pain for Pride 8 where Lucian Black was screwed out of the match by Quality Control and Dynasty was forced out of EAW. It also shows Zack Crash “firing” the Board of Directors at Pain for Pride, having them attacked and handcuffed and escorted out of the ring by Quality Control. It cuts to the EAW Draft Show where the entire Dynasty Roster lead by John Conning and Lucian Black rebelled against Zack Crash, and it hypes up the creation of “Dynasty Wrestling”. Meanwhile, it features the formation of Hexa-Gun and includes its original endorsement by Zack Crash himself, however it shows Hexa-Gun posing as Quality Control to turn on and attack Zack Crash at Midsummer Massacre. Hexa-Guns purpose for being is highlighted, pointing out Hexa-Guns desire for the resurrection of extreme, and footage of their dominance over factions and rebellious forces over the last number of months are shown. Territorial Invasion: Civil War’s inception is recapped as well as the War Games match where Zack Crash was forced to submit by Lucian Black and Carlos Rosso and be drafted as a wrestler to Dynasty Wrestling. The build up to the Red Walls match is then shown with Zack Crash’s continuing defiance, the numbers of Quality Control multiplying, and Zack Crash using Quality Control and interference from Alex Anderson to screw Lucian Black out of the Red Walls match. The continued war, the introduction of Hexa-Gun onto Dynasty Wrestling, Hexa-Guns desire to gain full control of EAW AND Dynasty Wrestling and their dominance in attacks is displayed. Corporate HRDO’s introduction as well as the strengthened Crash Regime is shown, as well as battles between the Crash Regime, Dynasty’s forces and Hexa-Gun in which Hexa-Gun would come out on top several times. Dissention inside the Regime leading to Zack Crash chewing out HRDO is highlighted, with HRDO chokeslamming Zack Crash and turning Quality Control against the Crash Regime and revealing his buyout of Quality Control. Finally HRDO’s Resolution is shown, with the announcement of the Winner Takes All Extreme Elimination Chamber match, highlighting the mental breakdown of Zack Crash, the defiance of Lucian Black/Jacob Senn, and the dominance of Hexa-Gun. )

( The camera cuts to the ring where the Chamber is already placed around the ring. The lights dim in the arena as the Ring Announcer gets into the ring with a mic in hand. )

RA: This following match is our MAINNNN EVENT OF THE EVENINGGGGGGGG …. THIS MATCH IS AN EXTREEEEEEMMMMMEE ELIMINATIONCHAMBER MATCH, AND IS A WINNER TAKES ALL BATTLE FOOOR THE COMPANY!!!!!!! Once all three teams are in the ring, two competitors will stay in the ring while the rest will be sent to their respective pods by choice of the official! After each interval of time, a new competitor will enter! The only way for this match to end is if there is only ONE TEAM represented in this contest and the winning party will have FULL CONTROL OF DYNASTY WRESTLING AND ELITE ANSWERS WRESTLING!!!!!

( “Would” by Alice In Chains blasts through the speakers and the crowd immediately fills the arena with a roar of boos. Y2Impact and Heart Break Gal both walk out onto the stage with the EAW Unified Tag Team Championships around their waist. Impact is carrying a trashcan to the ring, and Heart Break Gal dons a barbedwire baseball bat.)


Stew: Here they are. The dominant, the resilient, the crafty and cunning duo who have been able to overcome various situations and come out on top against the best teams in EAW! They are EASILY the most qualified team in this chamber match. Hexa-Gun has run roughshod over the Land of Elite for quite some time and NOBODY, not The Antigun, not The Savage Ryans, not Liam Catterson, The Iconomy, Higher Power, ot even the CRASH REGIME have been able to stop them!

Deadprez: As it is, they are already arguably the most powerful group in all of pro wrestling. Can you imagine if they were to take control of DYNASTY WRESTLING AND ELITE ANWERS WRESTLING? They would be absolutely unstoppable…..

( A mashup of “My Demons” by Starset and “Locked and Loaded” by Godsmack begins to play. Jacob Senn and Lucian Black step out onto the stage with a ton of excitement. Lucian Black has ahold of a sledgehammer, and Jacob Senn has in his hands, a steel chair. )


Stew: When there seemed to be no one we could trust, these two men have answered the call! When there seemed to be nobody willing to stand up for Dynasty Wrestling, these two stepped up to the plate and have put EVERYTHING at risk time and time again! They have answered the call of duty, they have been pretty much our biggest hope through all of this! They have been willing to march on the front line and we can thank them for even having a CHANCE in this war.

Deadprez: And quite honestly, Stew, I think they have the advantage tonight! They have the incentive! They have the desire! They have the passion burning inside them to fight tooth and nail for Dynasty Wrestling and put everything on the line, and I could not be anymore grateful to these two men!

( “Outlaw” by Disciple blasts through the speakers… Zack Crash and the newly crowned EAW New Breed Champion, Clark Duncan walk out onto the stage together, Clark holding the New Breed Championship on his shoulder. They both are carrying kendo sticks, and Zack Crash in particular has a crazed look in his eye as he scowls at everyone in the ring. )


Stew: And of course the ruling class itself, the staple of oppression, Zack Crash as well as the NEW New Breed Champion as of earlier tonight, Clark Duncan.

Deadprez: Zack Crash has been unapproachable this entire week, he has been hellbent on destroying everything that stands in his way which is pretty much business as usual. Meanwhile Clark Duncan has already made good on part of his promise to Crash and he managed to defeat TLA earlier tonight to bring the New Breed Championship back over to EAW.

Stew: Now they just want to finish the job… but Crash is acting different, he’s become desperate, he’s willing to lay it all on the line and sacrifice his scruples, his sanity and sure enough his body to keep the empire. And better yet if Zack Crash can manage to come out of this match somehow the winner, he will have more power than he EVER has had before. It will be a nightmare for all of us if he manages to come away with the win.

( “Outlaw” fades out. )

( All three teams are in the ring, and Quality Control are seen coming down the ramp to guard the Elimination Chamber as well as seal the Chamber door shut with a metal lock. The official sends members of each team over to their respective pods, and the pods automatically close shut leaving behind Y2Impact and Jacob Senn to begin the match. )


Stew: IT HAS BEGUN! PERHAPS THE MOST CATACALYSMIC MATCH IN YEARS IS UNDERWAY AND IT WILL BE Y2IMPACT SQUARING OFF AGAINST JACOB SENN TO BEGIN THE EXTREME ELIMINATION CHAMBER! Those two men are circling the ring and as you can see, Senn has set down his steel chair outside of the ring and Impact has done the same with the trashcan. This match marks our first EEC in two years, and for Jacob Senn this is his second Chamber match overall. For Y2Impact, his FIFTH. He has competed in the most Elimination Chamber matches in EAW history!

Deadprez: Impact and Senn begin this match with a few kicks sent out by Jacob Senn but dodged by Impact. They’re carefully assessing each other and Senn swoops in with the waistlock and applies a rear waistlock… Impact sends back a wild elbow! Senn ducks it and instead he brings Impact into the corner for some shoulder thrusts into the ribs and the midsection of the Quintessential Champion and the leading representative of the Hexa-Gun!



Deadprez: KICK OUT by Impact! A very fast, aggressive kick out by Impact and Senn snaps in a side headlock to restrict any freedom his opponent has! Impact makes his way up to his feet and is now trying to bring himself closer to the ropes… NOW IMPACT ATTEMPTS TO COUNTER OUT OF THE HEADLOCK WITH A BACK SUPLEX TO THE OUTSIDE, DUMPING SENN ONTO THE METAL STEEL GRID FLOORS!!!! NO, SENN LANDS ON HIS FEET WITH A BLACKFLIP OUT OF THE RING — THERE’S A NICE ROPE AIDED STEP-UP ENZIGURI OVER THE ROPES BY Y2IMPACT! Senn rolls away holding his head while collapsing to the metal floor at ringside, and Impact grabs ahold of the ropes and SPRINGS OVER THEM, LANDS HIS FEET ON THE MIDDLE ROPE OUTSIDE OF THE RING AND HITS THE LIONSAULT!!!!!!! NOBODY HOME, JACOB SENN MOVES OUT OF THE WAY AND IMPACT HITS ALL STEEL!!! The body of Impact goes CRASHING right into those metal floors and Imp goes rolling around in a ton of pain now as Senn makes his way back to his feet. Senn pulls Impact up and takes him over to the pod where HBG currently resides in… and he SMASHES IMPACTS FACE INTO THE PLEXIGLASS POD! AND HE BASHES HIS FACE INTO THE POD AGAIN, AND HBG IS FORCED TO WATCH AS HER COMRADE HAS HIS FACE SMASHED INTO THAT BULLETPROOF GLASS POD! AND SENN IS ENJOYING IT, HE’S ENJOYING THE HORROR ON HBG’S FACE! Now Senn grabs Impact, takes him elsewhere and DRIVES HIM FACE FIRST INTO THE CHAIN-LINK WALLS!!! IMPACT COLLAPSES TO THE FLOOR!

( The timer comes up on the screen )

Timer: 10…. 9…. 8…..7…. 6… 5… 4… 3… 2… 1.. BUZZZZZZZZ!!!

( While Jacob Senn is hitting stomps on Impact, a bird’s-eye view of the Chamber is shown with each of the pods lighting up randomly until they stop at one pod…. CLARK DUNCAN’S. )

Stew: And now the complexion of the match has changed as all three parties are officially involved in this Elimination Chamber match! Clark Duncan, representing the Crash Regime enters the ring and meanwhile Jacob Senn has a grounded Impact hooked by the legs… now JACOB SENN SLINGSHOTS IMPACT INTO THE RING, AND CLARK DUNCAN CATCHES IMP ON HIS SHOULDERS AND HITS AN AIRPLANE SPIN ON THE QUINTESSENTIAL CHAMPION, AND JACOB SENN HITS A SPRINGBOARD KNEE LIFT HITTING IMPACT RIGHT IN THE TEMPLE AND KNOCKING HIM OFF OF CLARK DUNCAN’S SHOULDERS!!! Now Clark Duncan goes after Senn with a lariat from behind!!! Senn ducks it, Duncan rebounds off of the ropes and goes for a CLOTHESLINE!! SENN DROPS TO HIS BACK TO DUCK IT, NIPS BACK UP TO HIS FEET AND SENN FOLLOWS HIM UP WITH A RUNNING STRIK– NOOO, CLARK DUNCAN WHACKS THAT KENDO STICK OF HIS HE PICKED UP OFF THE GROUND STRAIGHT INTO THE CHEST OF JACOB SENN!!! NOW DUNCAN SMACKS IT OVER SENN’S HEAD, AND HE BRINGS IT DOWN OVER THE SPINE ONE MORE TIME!!!


Stew: I heard it — and speaking of Impact, Clark Duncan has his sights set on Impact and pulls him over the shoulder this time!!!! Duncan backs away far across the other side of the ring opposite of the corner holding Heart Break Gal’s pod… AND CLARK DUNCAN AGAIN GOES FOR A FULL SPEED LAWN DART THROW!!! HBG CAN’T BARE TO WATCH!!!! DUNCAN HAS IT– NO, Impact lands behind him! Impact lands behind Clark Duncan and he hooks Duncan from behind… HE GOT IT! TIGER SUPLEX!!! PINNING BRIDGE!


Stew: KICK OUT by Clark Duncan who was just dumped right onto his head by that tiger suplex! Both men are down here, all three of them are down really but Impact is slowly rolling towards the ropes and it seems as though he plans on exiting the ring. Impact now tosses the Hexa-Gun labeled trash can into the ring. Imp returns to the squared circle and he picks the trashcan up and waits for Clark Duncan to come completely to… and he SMASHES THE TRASHCAN STRAIGHT OVER THE SKULL OF CLARK DUNCAN!!! Duncan drops to his knees and Imp puts the trashcan to the floor and throws Clark Duncan’s body over it.. and now IMPACT RUSHES TO THE NEAREST ROPES ATTEMPTING ANOTHER LIONSAULT!!! DUNCAN QUICKLY MOVES OUT OF THE WAY, BUT IMPACT HAD THAT SCOUTED AS HE BACKFLIPS TO HIS FEET AND DUNCAN GOES FOR THE REAR WAISTLOCK! IMPACT COUNTERS WITH SOME ELBOWS HOWEVER! NOW IMPACT IS TEEING OFF PUNCHES; TIMED, WELL MEASURED PUNCHES WHILE DUCKING SEVERAL WILD RIGHTS BY CLARK DUNCAN! Imp backs Duncan into the corner and the two of them struggle there while the timer appears on the screen! We’re about to see our next entrant!

Timer: 10…. 9…… 8……… 7…… 6……. 5….. 4….. 3…… 2….. 1… BUZZZZZZ!!!!

( A birds-eye view of the Chamber is shown with each of the pods lighting up randomly until they stop at one pod…. HEART BREAK GAL! )


Stew: HBG is directing traffic and she motions over to Jacob Senn who’s at ringside recovering. Imp backs into the ropes where Senn is at and HBG runs the ropes, charging straight to Impact as IMP CUPS HIS HANDS AND SPRINGS HER UP!!!! AND THERE’S A POP-UP FROG SPLASH BY THE MERCENARIES ON JACOB SENN!!!! PROJECTILE MOTION CONNECTS!!!! HBG hit Senn HARD with that, HBG HERSELF is reeling a little bit from it! HBG recovers and Impact grabs a bloodied and dazed Clark Duncan up from the canvas as he sends Duncan with an irish whip over to the ropes … HBG goes for a strike — DUNCAN COUNTERS WITH A FOREARM HOWEVER TAKING HBG DOWN! IMPACT GOES CHARGING AT CLARK DUNCAN, AND DUNCAN DUCKS DOWN AND SENDS IMP UP AND OVER TO THE METAL FLOOR WITH A BACK BODY DROP! — NO! Impact lands on his feet and Duncan rushes to the mat as IMPACT GOES FOR THE SPRINGBOARD CLOTHESLINE!!! DUNCAN CATCHES HIM IN MIDAIR WITH A TRASHCAN LID OVER THE FACE!!! IMP WAS COMPLETELY CAUGHT OFF GUARD BY THAT! Duncan isn’t finished however, he grabs the Hexa-gun trash can and puts it over the torso of the Quintessential Champion!!! He has stuffed Impact’s upper body in the trashcan… and CLARK DUNCAN IN A RIDICULOUS ATHLETIC DISPLAY SPRINGS UP TO THE TOP TURNBUCKLE AND HITS A MOONSAULT STRAIGHT ON TO THE TRASHCAN-COVERED IMPACT!!!!! DUNCAN RIPS THE TRASHCAN OFF HIS OPPONENT AND GOES FOR THE COVER!!!!



Zack Crash: **banging on glass** STOP BEING A (CENSORED) PUSSY AND DO SOMETHING!!!!!!





Stew: SOMEHOW, SOME WAY, CLARK DUNCAN KICKS OUT! YOU HAVE GOT TO ADMIRE THE AMOUNT OF FIGHT CLARK DUNCAN STILL HAS IN HIM DESPITE EVERYTHING HE’S GONE THROUGH IN THIS EVENING! THIS MAY TURN OUT TO BE A CAREER NIGHT FOR CLARK DUNCAN UNLESS JACOB SENN CAN FIND A WAY TO CAPITALIZE ON THIS POSITION HE’S IN! Senn is back in action after a big time blow to the head after being thrown into the plexiglass pod and hit with a combo move by the Mercenaries. Senn pulls himself back up and grabs ahold of the steel chair.. but Impact who has recuperated steps on the chair instead! And now Impact and Senn lay into each other with a hockey-style fist fight, battering punches into each other’s skulls at a ferocious rate! Impact collapses to the ground and now Senn goes after him with a steel chair… BUT IMPACT COUNTERS WITH A KICK TO THE GROIN!!! A BLATANT KICK TO THE GROIN TAKES JACOB SENN DOWN! NOW IMPACT GRABS THE CHAIR AND IS BEATING DOWN JACOB SENN WITH THAT STEEL CHAIR!! AND LOOK, IT SEEMS LIKE WE’RE GOING TO HAVE OUR NEXT ENTRANT!

Timer: 10… 9….. 8…. .7…. 6…. 5…. 4…. 3…. 2…. 1…. BUZZZZ!!!

( A birds-eye view of the Chamber is shown with each of the pods lighting up randomly until they stop at one pod…. LUCIAN BLACK. )



RA: Clark Duncan has been eliminated by Lucian Black!

Stew: DEAR GOD! THAT WAS .. WOW! Zack Crash can only look on in horror and shock!

( Jacob Senn limps over to Lucian Black to pull him out of the wreckage )


Stew: Zack Crash retreats into the ring, and Senn & Black follow him while The Mercenaries look on, still recovering! Crash goes out of the ring through the other side and is looking to escape through the chamber door, but that door is locked shut and Quality Control seems to have zero intention of opening it! Lucian Black POUNCES ON ZACK CRASH AND DRIVES HIM INTO THE WALL WITH A SHOULDER THRUST, AND LUCIAN SENDS REPEATED SHOULDER THRUSTS INTO THE MIDSECTION OF ZACK CRASH! Crash desperately tries battering down fists into the spine if Black, and meanwhile Jacob Senn goes over to the chamber wall and sets up his steel chair in an unfolded position and puts the legs of the chair through the chainlink holes… now Lucian Black and Jacob Senn both grab ahold of Zack Crash and SEND HIM INTO THE NEAREST POD WITH A DOUBLE TEAM THROW!!! CRASH’S BODY BOUNCES OFF THE POD AND HE CRASHES BACK TO THE GROUND!!! NOW SENN PULLS ZACK CRASH UP AND PRESSES HIS FACE AGAINST THE HELD-UP STEEL CHAIR…. AND LUCIAN BLACK JOGS OVER TO CRASH AND HITS A HUUUUUGE DROPKICK INTO THE CHAIR, SMACKING BACK INTO ZACK CRASH’S HEAD!!! ZACK CRASH GOES STAGGERING OVER TO THE ROPES! NOW SENN AND BLACK DOUBLE TEAM CLOTHESLINES HIM BACK INTO THE RING!!!



RA: Zack Crash has been eliminated by Jacob Senn!



( Lucian Black, Jacob Senn and The Mercenaries are all salivating at what just occurred, and Quality Control escort Zack Crash out of the chamber )


( Impact and HBG, still weary, begining slowly laughing )


( One of the metal grates from the ringside floor are lifted up …. and crawling out of it is.. )

Deadprez: LUZMALA!!!!! IT’S LUZMALA!!!!! WHAT THE HELL!?!?





( The brawl continues for several moments and Quality Control appears to get the upperhand … however … )


( A bloody, bruised Zack Crash is seen limping down the ramp with two containers of gasoline )


( Zack Crash crawls up the steel steps and into the chamber completely unnoticed due to Quality Control’s preoccupation with Hexa-Gun )









Stew: And would you look at that! Quality Control has now detained the non-participating members of Hexa-Gun and are dragging them out of the chamber! Quality Control is clearing the chamber, and we are back to where we started before this utter madness ensued! The Mercenaries are at a point of advantage, Lucian Black is COMPLETELY out of it and Jacob Senn is just trying to climb up to his feet using the ropes! Impact sluggishly grabs Jacob Senn from behind with a full nelson… and HBG SPRINGS UP!!! THE MERCENARIES HIT THE SILENCE OF THE LAMBS!!!!!! FULL NELSON FACEBUSTER BY IMP INTO THE EVISCERATION BY HEART BREAK GAL!!!! AND HBG FOLLOWS THROUGH WITH THE COVER!


RA: Jacob Senn has been eliminated by Heart Break Gal!

Deadprez: Hexa-Gun is closing in on their sovereignty over EAW and Dynasty Wrestling as Jacob Senn has been taken out of this match, and it is now down to Lucian Black alone! Senn put up a valiant effort, but it wasn’t enough this time and now Lucian Black is forced to take on arguably one of the greatest teams in EAW history, the EAW Tag Team Champions in a solo effort! Lucian Black is outside the ring using the chamber wall to recuperate and The Mercenaries who are by no means at 100 percent are looking to seal the deal and take Lucian Black out, and take full control of EAW! Y2Impact exits the ring and goes over to Lucian Black… BUT LUCIAN BLACK JUMPS TO HIS FEET AND CHARGES AT IMPACT!!! IMP JUMPS OUT OF THE WAY, AND LUCIAN BLACK FLIES THROUGH THE ROPES AND INTO THE RING WITH THE SPEEEEEEEARRRRRRRRRRRRR!!!! COMPLETELY MOWING DOWN HEART BREAK GAL!!!!!!! MY GOD HE RAN THROUGH HER LIKE A FREIGHT TRAIN!! AND THERE’S THE COVER ON HBG!!!


RA: Heart Break Gal has been eliminated by Lucian Black!








Stew: OH MY GOD!!! OH MY GOD HE DID IT!!!!! HE DID IT!!!!!!!!


( “Locked & Loaded” by Godsmack hits as Lucian Black lays out flat on his back, completely spent )


Deadprez: YES!!!!!!! YES!!!! IT’S OVER!!!!!!!!! IT’S ALL OVER!!!!!!!!!!! LUCIAN BLACK HAS WON IT!!!!!!!!!!!!


( The majority of the Dynasty Wrestling roster, John Conning, the former EAW Board of Directors, Sebastian Monroe and Corporate HRDO all come out to the stage clapping for Lucian Black. )

Stew and Deadprez: *standing up* (clap)

( Y2Impact is escorted out of the Chamber by Quality Control, and the Dynasty Wrestling roster and staff as well as members of the EAW roster and staff enter the ring and help Lucian Black up to his feet; embracing and celebrating him. )

Deadprez: I don’t think I’ve ever been more happy to see a pro wrestling result than I am for this one! MONTHS and MONTHS and MONTHS of injustice, of unfairness, of being shorthanded, screwed, manipulated, lied to, straight up robbed and it all lead to this!


( Several Dynasty Wrestling members hoist a bloody and weary Lucian Black on their shoulders )


( Lucian Black, Jacob Senn, and members of the Dynasty and EAW roster and staff are all celebrating in the ring and the camera fades to black )

( EAW logo buzzes )


©2016 Elite Answers Wrestling


Log in with your credentials

Forgot your details?